ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:33:08 &.(6HH Adobe_CMAdobed            h" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?u 2ccpna,/Bm6pO?y3v[kôɹA_rUEk!ںL ?szt@h"I/Zٺ}Gj7~\Ŏn?ޟl2V~;Z䚹p%@ʘ3ƚI ӡJ~o*U/;B꩹h__g^^^-UOiۚGi&rm ْ]a\_~V^wR׃6}[M>-i֙~L熴rkwe]{0kX_7Pz1^S] /C=xKٿaI#6gCwS:g^`j׳kDGghX"Bakmy}E.6MYVuh60{nosa:ֶr1$\l1q~>e1h"K)WLe 6^X>og3=SԬƨQ[\ mmm_\PYy5 +Ġ̭ݯK]KTZ(zΝ&3/vCKY[}e5:T{hͪl~p~k*}9x;+],^?}!<|Г7av(5{`%?=0l?;[S}lrq>pևGRM .cP#o9zddxji8I s6̈́? 8^t=UmXG-7ԡ:ڿ}$Xޛ`sA(?"@4x$25[O;I f>?Zժ5kʸoPp̋_cw6 TvUdyc{KoYu=nCm5<:KAwG35c^_K z9s.9/UilhcxJߧ}k^l%=?1BcXs s q1/n-y59iZ>NY/S Ye[̰5ϩ\x^ZYXj9w'mGQgpn+Ataz*|[[G|׷Ax YSko}^ߵzE@44zgtm{ao~acy=[=2{^+ew[/gפEUcmlkXtlg+ m纟O'9;N5;tZ͎sR6ʱ^~a3Wߐ%,S^3XѬp?wvfcg^2v-Z 64mcgzϩ]+ͽma-N۷c﮼C{kinֹݡ 6CR67Qޖ/0Hamh[?1'\p .kwtkm^eގ}.Β-x]X˛L[dOXR|γq,xWn<`6W[k?'Ǚԏ\^C&՜nGV{rSk$;H`Elhi,̃03c?j xȡ yVW?<۵Bp/?P0\lj -%KZO.~U\W 4VsK({%c۽7~ȲӑKOH5C}W}?f]cxon?yiKbϥmь6Cw o)THog/aQV_Jv1z\}7֪s}TUosZk^} SrHT&DiHLv[NF.^罘Hs?Msdco 6[~@ylq[gn9:It:?Tqך(063}=jY[68lK'3=XE7[;}6:J˿H8#gFQ(A `2 3oTq/{ Κ~_Ch٣7ws~F,5znnǰw1j2m~F챏>3|JYם{je:Rc{~>gվcr- v7Ǿ@{1b =w?Qq[NNK}dm8 eEpv@{ߡ%*f?2+hs G 1ùDW82ݜIwmU~lݶX[jG?1MeOƆV``0ͣt{J^/m\dC\ZzE57S0뱵ձwY~)q>TUX,/vƷ=Shְ}-m{xM 񶸼Hp wdXC+oXȴ'8^6sCOm@~ͳg"JV>S=+Ϣ5SےmTE?t9Rns &Ao'22ZIRD)hU{OW JqYTbMӄ&Ga nt_gqlJ9E3"{K^M>OkI?zwLrZlrDi|~#JcJpszu޾MwuGl ջWΤG}3PȬZٟ4 CwP{%{sFkMۚ)ߍ7i}Fw1ݕ6h ^9rd?HnGI{{𒽹{&}ukXm}{}|H6~oRo8Ls13mZ]w4<;uNU_qÌP~Gi/z{sꑯe!g$~ʿnW[~CCNHc[B{U?PEx4On]/rl:K\lڛC?eť{ǽ%_ݲܭq?ShܪZANj{ v}fo\zv˾[ozNݵWE.Xuo5}4Y(gk}*]%CUM8ﭯ;Mkhu(}G$7Կ{ kZIzO?~:hEim{_eN sik=f_מ}f}xnɳ tc}27ut7]CƟHߐ~e2{oۻrqs֪z][ p䌀;@rO25B^5̤4߳şMv]%/ Ɩ2%{lk= ;5ŭ¼HIR#{?S 3V?bZ~5/u/g\IjKGgMN#akI-SzulYӌ^prGb&Ԓ^}]H,b&zS9şZ}b_`#ٳ RKUhx.ÁwS6 ZN[=[=^L{{Z^\jӧ_OљԳlȢΧkhsv=_ī#Wo̱{#-!,Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU workbase_foto-21 nullboundsObjcRct1Top longLeftlongBtomlongRghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM h Adobe_CMAdobed            h" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?u 2ccpna,/Bm6pO?y3v[kôɹA_rUEk!ںL ?szt@h"I/Zٺ}Gj7~\Ŏn?ޟl2V~;Z䚹p%@ʘ3ƚI ӡJ~o*U/;B꩹h__g^^^-UOiۚGi&rm ْ]a\_~V^wR׃6}[M>-i֙~L熴rkwe]{0kX_7Pz1^S] /C=xKٿaI#6gCwS:g^`j׳kDGghX"Bakmy}E.6MYVuh60{nosa:ֶr1$\l1q~>e1h"K)WLe 6^X>og3=SԬƨQ[\ mmm_\PYy5 +Ġ̭ݯK]KTZ(zΝ&3/vCKY[}e5:T{hͪl~p~k*}9x;+],^?}!<|Г7av(5{`%?=0l?;[S}lrq>pևGRM .cP#o9zddxji8I s6̈́? 8^t=UmXG-7ԡ:ڿ}$Xޛ`sA(?"@4x$25[O;I f>?Zժ5kʸoPp̋_cw6 TvUdyc{KoYu=nCm5<:KAwG35c^_K z9s.9/UilhcxJߧ}k^l%=?1BcXs s q1/n-y59iZ>NY/S Ye[̰5ϩ\x^ZYXj9w'mGQgpn+Ataz*|[[G|׷Ax YSko}^ߵzE@44zgtm{ao~acy=[=2{^+ew[/gפEUcmlkXtlg+ m纟O'9;N5;tZ͎sR6ʱ^~a3Wߐ%,S^3XѬp?wvfcg^2v-Z 64mcgzϩ]+ͽma-N۷c﮼C{kinֹݡ 6CR67Qޖ/0Hamh[?1'\p .kwtkm^eގ}.Β-x]X˛L[dOXR|γq,xWn<`6W[k?'Ǚԏ\^C&՜nGV{rSk$;H`Elhi,̃03c?j xȡ yVW?<۵Bp/?P0\lj -%KZO.~U\W 4VsK({%c۽7~ȲӑKOH5C}W}?f]cxon?yiKbϥmь6Cw o)THog/aQV_Jv1z\}7֪s}TUosZk^} SrHT&DiHLv[NF.^罘Hs?Msdco 6[~@ylq[gn9:It:?Tqך(063}=jY[68lK'3=XE7[;}6:J˿H8#gFQ(A `2 3oTq/{ Κ~_Ch٣7ws~F,5znnǰw1j2m~F챏>3|JYם{je:Rc{~>gվcr- v7Ǿ@{1b =w?Qq[NNK}dm8 eEpv@{ߡ%*f?2+hs G 1ùDW82ݜIwmU~lݶX[jG?1MeOƆV``0ͣt{J^/m\dC\ZzE57S0뱵ձwY~)q>TUX,/vƷ=Shְ}-m{xM 񶸼Hp wdXC+oXȴ'8^6sCOm@~ͳg"JV>S=+Ϣ5SےmTE?t9Rns &Ao'22ZIRD)hU{OW JqYTbMӄ&Ga nt_gqlJ9E3"{K^M>OkI?zwLrZlrDi|~#JcJpszu޾MwuGl ջWΤG}3PȬZٟ4 CwP{%{sFkMۚ)ߍ7i}Fw1ݕ6h ^9rd?HnGI{{𒽹{&}ukXm}{}|H6~oRo8Ls13mZ]w4<;uNU_qÌP~Gi/z{sꑯe!g$~ʿnW[~CCNHc[B{U?PEx4On]/rl:K\lڛC?eť{ǽ%_ݲܭq?ShܪZANj{ v}fo\zv˾[ozNݵWE.Xuo5}4Y(gk}*]%CUM8ﭯ;Mkhu(}G$7Կ{ kZIzO?~:hEim{_eN sik=f_מ}f}xnɳ tc}27ut7]CƟHߐ~e2{oۻrqs֪z][ p䌀;@rO25B^5̤4߳şMv]%/ Ɩ2%{lk= ;5ŭ¼HIR#{?S 3V?bZ~5/u/g\IjKGgMN#akI-SzulYӌ^prGb&Ԓ^}]H,b&zS9şZ}b_`#ٳ RKUhx.ÁwS6 ZN[=[=^L{{Z^\jӧ_OљԳlȢΧkhsv=_ī#Wo̱{#-8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$]TDѓ&/ի.d>OTK`)OILW6Z%'A^S[qqK~Ωx<R~_!s=U=bK96(~SOG/9-߸︥[qq^Q.Z*9lS? a5Ëyu%eu<Z:kݭ>"~n}z{R/Ջ>gꧫIb>ȥEW}wR-߸︯Fhycu$?bFd>OT$,~E]["tyO_ed 96w$?bNdt>OT.uK ^~୷6Kw;)}wWwH=(O!s=U:,aͺtrϲ_ebrXg|Iaݟ{F?Y_~~n}za%F +'Ոy%7eF 4y__e8@RXg|Xtd9(~ȓ?o_eq(|CV'{a'wX^N*G2^u[qqK~qQOT줱~E^?_eIB_H{OT$ݗo ?>yn}/YY}Q/Ո>:Kyűh.2W[qqK~fu<~1k|CV,;b)wR-߸︮G? ?UO!v<S47wR-߸︮?UO!v<S4ۊ~w;)}wW]| h_Jw$?bgꤩ!)n+-߸︥[qq]o ?_o!X;^3?RD}wR-߸︮G? | V?ćW>OT% 6/_e֎y'}|CV+{a'H_eп |?ćW3ICS+-߸︥[qq]o ?oXo|H{}rew;+KG 'ՊO~n}ur?| M?5O!U3IBJb/_eՕsr׷~D+|CV'{a'H\8*ly+-߸︥[qq]_?_r?|?ćG>OT% )I\n}/?hd~~%X;\l?LPRW)[qqK~⺿9h~Xc/i(IJJ>w;)}wWWG#?UO!>OT% )I\n}/h~Jw$?b9ؿ%)+-߸︥[qq]Gw;)}wWP:G/y~`Hps?T%)I\n}/?i~%X;\l_U2IFJRW-[qqK~⺟Y?~S ~`Hps?T%)I\n}/?Y|CV'|JS\n}/?i~?~`Hps?T%)I\n}/Uǫe?pJw$?b9ؿǟdd9[qqK~!2|W %X;\l_U.dڮc~n}u.=Xo|J%O~n}udw;)}wWG[+ V?ćW1K%}wR-߸︮WC|*'Պ;bt$ϲ_e~H~l V?ćW1K%wR-߸︮ul?pKW%X;\l_U.d9[qqK~?_~l?pJw$?b9ؿǟ]$.s~n}t|/ڹ_~`Hps?TI\n}/j~_r|*'Պ;bt$ϲ_e~je~UO!v<R&sew;+ jUO!v<R&7[qqK~3r|0_Xc/I2K-߸︥[qq](?~zW%X;\l_U.iIsew;+ ~|CV+yL>w;)}wWIW+ V?ćW1K)\n}/j~ڹ_~`Hps?TI)\n}/?j~_r|*'Պ;btJR_e~jUO!v<R&sew;+ jdUO!v<R&s_ew;+ ~|CV+yM)Jw;)}wWKS'~|CV+yM)Jw;)}wWGS+!Ce?pJw$?b9ؿǟ]$Ҕs~n}u Y'#WD|CV'yQ%@C~n}uϿzH|CV+yꤩ!W-[qqK~⺏Y?~,?pJw$?b89ؿǟf_~n}u|?,?UO!v<S$d%rew;+K#zp~O!v>OT% )O~n}uG~~|CV+y꤉(IO%rew;+ ~|CV+yI(JJw;)}wWSK'~|CV#yI(JJw;)}wWQK'~pw$?b9ؿǟd+-߸︥[qq]?SGd\l?NKɾw/=-߸︥[qq^1)paCV+|Icۿy8̻wR-߸︮80O!v>OT뤲U2l??_eܜ’ylq&<wR-߸︮Yɾo#ÇXo|??}wR-߸︮vopH{|l?MOU)W'~n}vjKd^3?Si%S^W[qqK~co&e$?b9ؿǟm w;)}wWiy/[paCV+yJGx/~n}vle߼$?b9ؿǟlKww;)}wWgۿy/paCV+yJGx3~n}vmm߼$?b9ؿǟl$Kw>w;)}wWeۿy/]paCV+yHx7~n}v?nu߼$?b89ؿǟNx+-߸︥[qq]nm?ćO1?Rt=Gxϲ_e}K~{'Ո;b;?wR-߸︮~o]aCV+y zK{W[qqK~]ߑ7ۯȗ$?b9ؿǟNxwR-߸︮~K\{'Պ;b2H;x?~n}vo"oߑ. ?Hps?T$-rew;+}}?ćW1IA|R|W![qqK~ߑ?ۮ佼?Hs=?T$M+-߸︥[qq]ۮo"^$b9ؿǟN%+-߸︥[qq]ȗ%GV+y >w;)}wW]x }{x{'Պ;a'J_e~п"_/ȗXc/W#[qqK~. ?Hps?T$->/_eп x paCV'y꤉!)n+-߸︥[qq]g ?o9~$?b9ؿǟHq\n}/h~Cd\l_U3ICqKq\n}/h~Gd?\l?LPRW)[qqK~⺿9ߴr?|paCV#yi(n)I\n}/h~Kd\l_U3IBJRW+[qqK~⺯9h~?ćW1LPwR-߸︮,?pHuG< .?s(`|7 ~n}{)#訷թtCW>OT*K֮Cw%Z?ew;+nĬ6Z!rW"w.[EOHߨ@>OTZKo֮oEwYfBw;)}wW@z_Cߵ(8p$?bc/)$-߸︥[qq]67Xpe9l I?քG3-$Nzs24^_[qqK~{~cW?p_ w>OT/;Yzc7 ߬]@q^E[qqK~m4IduU2OfrCW>OT. {d7"^-&{@^w[qqK~{ [;%aqᔄDkHűZT:EP_S\n}/X$,<0š|8 2Nd ?NKW~AnU=WqK~ⷬY]?pPk3!EV?ćYv<RTIb}wR-߸︮ߡd<6WEj\"~n}z`zmxRKfg_ >3U=KeNvEv:-߸︥[qq]G\ȟcc3?U3XG0:bI07n}/"+|CV"ؿǟRI$w;)}wV|Nc6 V?ć]4/In}/jVIWѫL?K:h xȼ~n}z j`&~Еs]U=K_)?ff\O//-߸︥[qq^wRƫJX-;?h9dO@˪jǖt>[qqK~⺛zײ;AT_!uo{ӋlJ ZM ^ֳP~VU1ӏä~bsx6st B Xw(:W'!hsC|UqU/3cŠ[ I8 U*@)MnJ+F%XQH'hSW%# v RB3XrfɆ=TwÁ ƈ՝BiF@.d'NР8#:H7PID#놡GyLh)(֒U[5Rxj":EfjʊtwN0)8%8Q0М$[2@B*AID'%n#ZTS)S4Pƥ`H=&$Z7TU};h<:!]pU 5AS+JWsL0\+h cAlmp|c :\*}%eFwpƒTH I$L'%&N9JI)I$'-L tM)% StS)LIH Rt(p*^R&ڢD"JdN uR(JP!;SnRIժ Jt'I6Fh2 $$I&NNBMSIJ)$S!% !t$RR&1RڑjIRtJ H'INҎ*IpX2DcPHVeTҦSBNIPd% )tIE%(Q!$)$M)BpI$I1 )I$*d(I2tL!@:b2tJRIyQ)RNJ!$t)'zIJI tI$)$I$IDHRI4)rJRtAQILRNTIPnI hRJR&IFPJ]2I'<)*ԒI)ڒtAj ]:`L)C a,tnn))IBI.S(!)hI:bГ#bޒz,IT H!t<% )IPDdڈЊLScQ DBIФrBiQ) D(NS)IJL$DAS%,IHQ(ӦI0SE$dD .L bRRI:t)JRR'I1 I(NZԔIN pSIRI$ TRIJI$tNRR$RSaGkPaLXAX +*-$T It$JRI$t:JRI$IIJI$)$$I$HRI$I$I$d%)$NdRN:I$I$xI*I$:I)I$hI$%)$N&$LI&))I$)LI)I$I )I$yLRI%)$I:P%)$&I:I)t$$$$IN$$II$N$xIK$I$% )I$I% EJI$BxO %)$RiAb )I2&LJ:I$IRI$(ptLJRI$R"$I$$$ILJRI$b$IE$B$d )I$AID)$&N1I$)I$I$JRI$I$I' R)2tJUΡ%aΌ"gq )$%,$"$Ja$:JXNS(2r J*\'L$RI$$% I)I2JRI$I$H$%)$Ip cD/|w2'E)I* bI$RdI:Z$M )x`+RݵDz72ufY9c yXSmF2z:4L_l$IL>vI xY@d9ߑi~zZL P%frdܰK1;9٩Z h;$ FD IH4I$)$N$U$N$RI$I2JRI$I$I$uq{3O(Fo1zMI$I$ I$_aWlb_x/+w?=/d^c,?C7e2r dP [LT+)9ڦI$C2*gHUsq,3i!'LA D*#!2sy5ɎWaW]%P]s2Q-GSǐa,jI uM76 1(W<¹`hbEY[5r"[%X'seU#Uhhf9&ܨl੶T4܌$yE'DXT4Chf@)Eo(DR+4*UmvFT_)ur# \4VHWj8PSEA УR@IU" !4ꊛ$$$"hHZdwN"Tw"Hke3E9Q.JSl1B0uI"! !2lu1QR'x"ug`Jz)'( J؋ N*hM*{\ #f!cf[4uHh\[XX+$J3PXheIYrP gdJ$yLN:t"I$$I$I$$I$dI:I$I'LE%)$EY ܤ)wS (RtNR'LJJJRtN`JQM NdBВI'I2HI'Nd!d!TBu&PRR2r"TR%$$LI)I$I$JRI$dRI$2rHRtN$HN%)$KjA$RI$I%)$I4'M))I$P iI%)$H:I)I$I&NI$)%)$R$ Dnj*J]#v@B,ũxM0<yMTVP_]̅t}$%,2xLI$LIJbSJ*]2xO 1)- JI$RI$HIJNI'pRRJE$-RĤJ@!ғʈ))N NRL%1)ӤJiI%,'I4) RI)H'$T$&RI*R&IE$$LdI&L$I$$'I:I0%p+(| q>"ONs+m[Sxwk90?R:d9ڒqHi-:f>Ʒ9"u32MFh'̭ z =ZL8 be:U2' 띫OU&gqr~V$J!h?Wʟ# Tʼn 5p(9O̊UGa'bGRX3Ąx\-pVnAⲝ*x+ l` Q6mBSp?W"4+AIWQ?}\w ,2Q鴄KSmNiJRЉ-\C2'c)Vô=v cb}+ JLjO}6]ʥԆa£OYe:Kzq=FX-0xf^m<^[u S  7YPͭ<) , ˤ'h:*L{͏J=δ W<ܷ\%S)ɝS*'VIMhhRI$$)$HTexmI$jYRfYh҃c %:e\"Bt⢒IjI$$I)I$I$JRI$$HRI$$:IRI$dIJI$I$RI$I$I%{5{_>?yCJ59jI$:I$eRI$_aWUM^K??*VTէHZ?l5y)2?XywֻMO!R2m'XN=1VG&$dJmcr?VvKqYӥfCzJo`)> ʋNwQo2"@Ss=! @PV!-<̭*ϫW1X`!T E3tM\ڤ~- O!ŽuUIH*~ 0PcChDTvj>0Ddt(*Q&[((J8:E<՗_谠dV5װ vL\ &_&>=RL)O %.I$4'IJI2I$I)I$I% $'LI )t$RHIKJmR*-R))bE2I9QILI$$JRI$;S$ԔIe.)%dNI$I:d$IRI$8L$&NtI,I'I$RI$2t!I$I$JRI$I$I$'IJI$0NRɓN&N$IԀLJɊt8R AbR*)˜Q AJR aD)TġIIE8D%(󮩨mAegeO>i:/l1:*M.[X4< [`Jֳ)W@%wuQܕiQl@h^3[0 <̊2ѥәPhR8C+kyUhk*7)d^Ѫi-%UMyB滺N.'M.ZaZ;З޶L O8ޝi^mҝpT*dƨZzyn4"V+Uꬑ@(G lbwonQZX\ħ\XB#l%rŬZX% Ð*hJC3RLT]s`CȰi*@jXgN,lgṹMm#d4>7n /%׺6nLn)Q638T 0[5 !e(_"^ʶ05\gt .A{ߩB}jLE4+ pnulfVF)N[ǭuVˆ#eD P/-*e䣰cL'p;Z!s{f]MWz.;h$_ 7YIXy_l euu.{􌄆1yG9 j0z5T4 +RVbTKnldekJٸt'U9zJ1#Aftav+k^SYc hZ%1UļGW AU2le 2bUurVwl,xk.w۲Z%t=O%wN߫Vfq/I,=KlW`d+2#ߌFr)IV3%V-c1)#5ˏ"I2,FP |aV$ld2teE:d5$I$dI$I%)$I$IJI$LSI&JRZI$NTI&I$JI$I$I%{3{_>?yCJ59jI$:I$eRI$_aW`h g^ұ+2XfNQٱO0+}UynU-^safN|ZūK}C#9Q9M2K%'B86k!8 Cɱ0Fv9b{+[;<[ &Us$nJ@wuGeiE;GH[hz*Fys/8wdcˤ 5 1* j 8'B֔ۉI8 (W̵SE<{0Z5Th h(V'q,h+t WJE cO *Aٯv@&&PO(NneS6qEMfiXW ÕwHN衻HS %yL2IJiM\֔bR GP`V`6E\%>אah{1C*:(1ǗkjU;SEL$!LS$eLdj \l1V4b;%*|ޠABCt};Nǂ-LhV)7rU' IzSjV Za)ФЊҐ82tW(PE_uQ,M;Go}.s®yGU8kX)($2’TmHL )&R$PTiN$$$tL$NIHBJY%H=A1NtQ:CTv6Rpba eE1Nӄd铤$IN%)$I$"$I4LTI$2tI$II1L)ISbIX AE1N(]$LI RI$$$II$I$$I$tRIE$2J]$I$$$I$JRI$dRI&%D9%)$TLH%R$SJJ[R )I)P)ItIJRI&NHRRI$*"c(  a3ZV ;  ТFҦ(2w&Ik4ID)t'I3LRRI$ʐIJI$&R)IJI$$dI:I$I$I$$J%2r%.I' )I$$I%)$N0NRI$'IJI$LI)I$d$*RI$@(VB RI&*'E ;J]:`:dRI2tI%):d$$ILI$I$I$I2I $I$)$I2I$$I$H)I$I$HRI$$"$II$I$IJI$$d'I$dIAj.%)8I$6J( .:e$ $$I'L$Lt)I$I$JRI$I$I$I$$I&NI;T@)J) L2b9LI$$TI:I$I'I$)I$Id)I$$IJI:dt"$I(% 'L$€R )I$tH"I$t%)$H)& RI$'QR'II)QI%Z'I<U'I<)IKBP$dR'II2I$NI$IY:II$BI:bS$$JA:TR$)9E%.d$I)I$dt%)$D?d%dI$I$)$NI$$IӦNR'L'L"$II)I%)&NJ]$QJ )I$I$%)$H'I$I$L%)2t)ӓjLdH(0SD邐IQNSH& p bS) ILQ RNS1R)IE(ӀNQ)bdAI$`D DhPrNJ()RLIhtl.lWUBRY=.DPrg\|P!KWR Q*T!!lY8[UsU*_[a]U0ڮ'JTK6)d<'ڥ)J`HxJҔIJtJH*Bt%(!d $6$tLM).P )'JSJRJ I9&E DQ)DĤ$I$TI$I%)$I$IJI$#jT% $$AJI$I$RI$'LPt$t$I,tI$R'Lt$$tI2JY:I$I"'L$$RI$I$I2I&IJI$铢I1H%#*.IJI%<:.V.xhF( Y2i!UlV> Xma=N "mI+#+J^d*(u"T֪ѠY7ewMt2B\䕥F+X!h6Y\^PTJS'v3"ZpI$E˅afRu\!p1qBswrDYO1ҪJbP2%FEi ^Du8Z)/)YW!Ќ΀U-J^MC[l0@Sw,Xdg^ʆS}];Q@R<+ .l__#('na<AbUwB a(X jUlŭDJW #|+Y6[ ; AV//Y[Mh!Eͅ`:-Jr̕43 L!s,;|| W0\{r;KbiD /dr]"q(dbSZ 0tU`4 0E۸, >QW"`bmcIp G58r7ؽHU>kcwr7Mw COp] rP05@>^yUp 'Ff< )zZNJ8ՠ6>U^  뛼{$P3Rܝ1`qV8x2j8>*٠=XmP nAq V}[UPW/+{fq[sJYg+WtW2\Bŷ<,lX Ӏ 6k2>ଂ?!UMk Ҵ.lh&~w@BRH *VAIɲ<:,2HLSLbRI$]RI$'I%)$LI$$I$I)I$IIJI$I$BI$JRI$$I*I$I$BI$/Ruq(?OI$X$I$_aW o!yF/ҽکH?d[?Jb}UpoYF̷ s֮sK,3%#+}iՄllɭ{&@ ߔS¯ {H`/D3=0O4kYn.s^ 1F:ۨk琶[S?dk\u+D`MMJnB OBL5DyMST@G DdB(; RSLBq(vm:)!Uw)DxBN)UП^CQqB:r($c%aIlFYUBD4'DŽ2 =g^H#QB؞6WW0ϒIrGFʻ% "T#H9EBp--EU‰t#p@sʛ &-t(!!"mC}i&X]Q0Sl9d)ztp`E!j['LVQ Q]*"QP}WVvHV@#5BS?B*-NZ肗hz[bXU@r*A]R$j]Vh(j %?d_creusL (\PRZ((BqRPU mX0_r[JERQ`%X>QH9h TbM))@M )*!T*Myڭg6P -=J=e^lPK@c61 a@w*;1յWGҟ@R Sտ%yV˯z-Ϫ >+ _YP+L. 3/u36WQȅĤJ+jR S֨>ƵU6L5kH!RUu쐨fZW ֹw-s! :. !oXusĸX{.vV5h(_+MukW)M@" gE H'Rb[WKL[ Sc~bXG>kFÝ/3R<"_gbϮY|WV?{ݠN0_J6,߫].if1Eط>*o C $'q;X_[k>ۚG[عe7uNzEbCdyj@|路 ]t+3>.FXN,k9,KLDc9@An$&RBRI$I$I$I$$IJRI$$AjI$铥RI$$RI$I$I%{5{_6?vQޟRI$I% 2I%_aWv_aWnn/Hc?)Uun/ ЬqWpvhgcZ ivm23MO!rx]cT.Ň(dS)PjɎU/̩nl6riȽAB}ZKaI UaTKDJl 6jǽάC%IB#`'2ٳ;aU 9hB)$JZQFO49vҠ%V>SCBWT-Q+<+-Qa@UqNAIQ ̡Ѣk!&HN:" JjJ=6Q)mLD(Bu(Hw[L1PQhRw-+XaV/t%ҩ]"ʋ[)?T}'uVibfS*kFd٬)ݕ*.{HP!ITԄqVtA #E[?Vv_4{ qKF%^b kD}87p)1FfR8LT$d' )t$)B`$$I2t$$I)JBJRI$ uR')LAJI$B"`TD5FS0Qf锔JJ=mlI]%?qSR)JbS$$IӨ )I$tJbRRI:t!dLdI$LSbd'L%)$'LIJI$JiNIKN5NZ*oI=JSR!E$2I$JS$I'I$RI$LJRI$qD$$J)&I%.I'JR [RRLIBI)tI$Z܄Q`o((’(9 ڂҭeu AGvMIB9SDKrtd'%4JRI$Rܚ$yJTSI:dJRI$@JRRI%=қt(iIJI=4)hNJ[\e1)RН$aI$RI3]tBpHIJM I"%,$JyQ)I)'QHI'I<&))I$d))I$dI%):I&IKjhIJI$'JI2fWt`HE2E$I$JI$I$IL&)ڙ%,I&I0NI$)‰ I 2tbTI&%4*)!I$H)P Jɓ$RI$M)JJRI$:tIA!B@BHRt)D/ SIX RLriIK$$)RI%$ĦI%,$I<$$IO RI$&NI'I2RNI(JSJJRI$$Ҕ$I҅R%)$RI%)$I(L$$IBt$&I:t4))d(JRII(I)IK$I&H)I'I:RRIO)RJY:I&N:*RI$%)&NH$:$Ia2I)IEk[`T-M ;T#9 6!`II)ÑJ2H%=8z aJP)ȩd$I$I$SIJI$+B*—QL PRt$МLJ]2td$yNRI4I+$JA(Qथ$IM:t$#J]2I% H)I2@' ' )RP$)RI$$$S%):dBxI:JRI$NJRI$'I$$pNIRd$H& H"%4S' dS% 2HI:JA:NLAE8IK(H@J7( S(nI  "4()"5A!@@aIEI-^Z{d'?[k!]DM)nuAޟ"r_@"FC恛h(X%L(Th:!rOGbbVD|L-.{\}ˮW ~Y.α7a}st o,_߂(cVG,Q\g4jq9JV;=o.! QYٵl @jul3(5,cUrq^݁PUy YJ4)@7ir_X2UscD\&VLas+eUhgyWz Tja0N * }s߮ݠ·f0 \R  ViAwMI )e$R[Tu{=~ӽ<{ھf5'JzNCa^:uCQكXX \'Vu[\sAu9]+gAyZ WvY*Ռõ_+F ]mi[HwxXl3TVn9Ć4C߮ \mu6q-򩵦בa=,t5DoLJ`R{qU-[o8P&ӡ-e~)svX x!э[gBN*c:6|+.:+*v^ȺSyk%Q\.@uUkj9GLKͬ"I'D]R'@CUq=7*rX>uRh4!k&T='Hvve:A+%ci"[|Sv@:@l+ZLJh=5 y?'Vu+ݽ!8ݹՏtwS)[WC1XLv:C"dV'hNΩT"$RDE,#M#Ӫ&HC&iF%;Dq捔nMZ?g}oh.a;[fQ ;8B^yyG?Yt*Jwl{@w8OU [_7Wx7K}UC&6OmR__"Wd'ks›}'~5Ai׉^Oy-n$ ]b5:r7V}! +Uq 4I*[c^%E%[[3ͷIΞnu x/hynI(EJL$CJJtЙ*E2J\$I2t $I$I)I$ JP֧EpQCs)N p*$zabO'ZIR-Q!5j'0)DO>BIJiQ)Q()t铄ɊI$$I&NJRI$S')I$JY*.Z<'1%I`$] fPұP[`"ЄxE3[Ce7ky+3rϓ®\BJ+c[$H6Z5pUJqAll7hg2-\F+F< \uQ44mR ڕ2+6YWs\$ f9WX(p!9Xe-JFe-P.!sGsjT$da9ݔ_v]}6]px# '#ncΆ/~8.'=Rϴ V6 ذJD)k- /!38I^+o~r0Jк7p,teoI.] sWz.Qh$cEU0,sᑣQZ w6\Tԩvgu+YP8l[ ^;Y´ž1vtK[_+SlYR/+NT{0%NMI-g[l&qgdIEhqثu ge]EݏWt*r \GګB0f8VwRg^5a{UJZI-jK:r.Ƨ4jdg9!eep撮| w(N)ࣘ t;UW9k -64TotAڜ`n@`B&8w :vޚ)*ܹ޼[{,>"V)£ @s4P=O%UΡsv=PRGe~fWHUr>j@XqrMy$X}Rat|dV6UZcU+-1`![蒬&; >̇. . P2XZ L *1ha^<1O ULxqy>$nʴܺ>m\.+'Ժ ώX/w[D!݅UMwck&VKR (*>sr;.95W16d'vE?!N%jetʲV]WSZ% jfT̈́-'$Tu+;l+ͭú#q )y[@p,잛e?yCJ59jI$:I$eRI$_aW}wyw,72-g1>rwi,ܓ/xW+>ЦUJjʬ]q.gn~EEDnElʦ5j@+\Z)V_X%  x:=CW9pla: RY Av8 c@Fƴ:4iVw&ܘ-QA*CmLdr`uM>5AcB\[jjRP=ȍֈV JuPƸX`k (ic[gf7PQv%[ g@uL'V,P7q$rDJ zNoBѷ 4rhD:D2Q:;6#\$Pc65JK²PrY"oG7.4 CT\Q2Vl+EʶC3qꕙz;74^)͍QM(S1Y#0vԞM BUou$ R+(tJiIQr&Kb()8nH:Rc-gmd.*ԭ ,EpnjԮG+uJg ӻ|5! N 6oЬƊ9YDzCoR/蟂qCG$QcO.W Cӱ>PH6k1I$TӦI%)$I8L$,t’pTI'N:JRd$$)Y$I:d)I$I$JRIR  DV+CUD#5_%a H yF4UJR +Q⌅Ve$ВI&R 8))I$bTʂJ*N:SE%,I(I$I2I$L2yL%)$N IK$tĨ&2JuRsN)&) )LI$tRI$' )I$e0 &N'$A:IxQRܒI$9G q*EvdG A %$:hN $J]2Iӹ! I$'I$ВtRI$I$I$I%)$Lt)I$tI%)$Q)'LI&HYIJN8L  &NS&JIBR!E%)$JPNI$:dI0DjRR S'D4tӦI$RI4' 'I I$JNJRI$ BRRI$I$I$:b2uBr)$DLII&!(N%.I$I$$I$I)I$pS*)R'LH&I%.$Z)$Le(JB$QB]IEI'D +(%,tɒI$I2t $II TI( $$ILIRI$$IJI$)NI&:HI&I4'I$dL:H)tI2ptI2I$QRI$M)RI$JRI$X+X܊t:ŐŬLt6:QT I')9LNI$$I<)$IJI$JRI$IH%)$QI$BI$I:)RI$I'IJI$ɓJRI$tRI$IJI$)RI$&I%)$I:dRI% & JRd'I2tI$I$I$$RI$'I%):dI$I$I$)$I$IJI$I%)$IHB9t2g_=$ Q=SWz3tݪT -"a P)L}*oKLq++WIEWߔ zqi }xXhs08!ڭ6Xu^-U  z~\f\р Y_+1ƻ 5SfJMc,ꑥDKzmsܕ[bL3[m7Iff^n an0D(*܁ҟ6O}ikY D#kAkJ|aUroʲHPp4솙Ms$|VM uc{#Icd cS:Vth:T;"g#E=hsLD4wN߮ ߐ8vCku,kbNM["1qc_F@C6CXmYVYqּ xv<[ ;nJ>J@ %AMd\,}BƇIBIJ/4sڙ̓.=hn >UvR {S5$R Cs0pcF.9K'K7'{YD˜~1)QK ܦ43%@{)Rϸ=RHiSK9-mvosU+h kơ'HR hQlNJv'_$PsƇx]eq8hipZ]{u(@:)Ӱ68ue c%IVW/s&xMTs ăp ҬC`qώIX= {5<ς&ve\x so23TA n%5JA~[HX=nc"4™oC6;jis-9ę3ÿy;}L.ݒn6MB $Z_.x'Yͮ}Bw ))@e0]Dz[sGѰ^n0qvf4Ϥu ITkX8}e.Ǝ=ߜmIQVMᨬ׺ {M6KH' h }iԣ㇀6Jô=ѧfr xhh>u2~HnjT$oThƥ߼4VX]q #X c6Fc]Nۘ[˗!IwbGX}kz B_\~=.ҩ6uv5cpoKgs6-0yHS.{&8HOʓyLRR$RM )tL%(JB&E(NA+Iaݤ!T'؆$1ڞ]*& AJ铩)J*[,tTHJPN$e%f.>е9^`!toˮ/p`/xغ0>K45W_W@c īg@hM3 Q64w >n%ЬgƗA?=ˊ]g }. mJ; n*O>u{U_?5^uN]sul}6>g3׎km`c_k䥏0c\25Zt9J2{8G`: Ğ?sP/!iqDQ$']M0¯^Ycཻ[*%ZӢu:=OtRua=ɇ5wBVU!\>o'c^cpVSq\}1ΥUƬԭ-ЀOfOӂ@I7|G,nc5β{;ʝlncjfJ m5R LLK~~;+ݺgx0}]A3cϼ1Tvj};sd.զ 8pVqqOp3H* 87sP>-iIOgc乆 qK wIu׸B}K /#F@tH]-{q8X3z> tIVN)pO^8nޱWzOqK%3Uͷ1+׬Od5f p|#~I%hЍPbJ 8Ûnq[;BpЋe!k(t a8hl`%.9k(I@)lBsq]N-kTLec ,|KVaI&Vu1KpRv@ ,UH uWtmd¹C{ +mT8+ BAiZw4ZYA'h[VKWj|WVpmUW: CUeDhS6ࣹA2j2\Q]mr L13( yQ.MJ'TP"J(b$*2Q*ɢTl0@@z8l J3jU/i \U;CBz(u*˵ "+5=vn;DHhdT5;!TEP*nBq6#ڎԣJTO=9ZߤSt hl;3֗L9M_ 4$PI%%%)2t I$SNRI$$IRdI$AJI:dI%)$Nl)ƒHRMI8BVVGH !\4ECc!b%G0U: $$I$II&C'TEQRtv(P i)E2t)'LI$LRBNI:JRdI$RNd2JRI$&rt%,&NJRI$dRI$JRI$L2JRI$*EDLDTJJRtvF-YliP},B*@!Z(aSBaD &*E1I J)$J]$I$RI$I$I$$I$I2JRI$I$I$I)I$J))Id #! 铤 d)ҒI'8)JRI'Ld)I$d$dRE8IKI%3‚eI$I)$I$S%%)$QN 'mi%; J]%Y>\?&Fv% ))J7NAQI(RIJI$$I)tI$I%)$I:dR'I$I%)$I$$$I'LJRI$:dJ'I:I$I$N:JRI$bRRI$_2 II'ImDIAt$I$$I&HJRI$:I $I&N$)$I$$$II$TI$$I$0NI:dI"2IL.I$0NRRI$ɓIJI$N<$$I&)TI %J U: HVCL K!F$I!I$I$JRI$I$I$IRI2d$)tIH)PO(IRLd铤JRI$t$&N:I$I'I$BI$I$I:I$I$I)I$IIJI$TQ JQLLIRI$I$IHI$I$$II$I$I$I'LI)I$t$TI$tRL2t$'I $$IH&NR$N'I 'NI$I$I$I%)$H)BI:A<M)SmNw:k%j]%XUgLv/'Z < $Cm2ʷ ખjcLiV@N[FQY;+἞k [4rȍDZWӫj6;r䡿&r `-3Unw{]ײۃk"ZWHfTE@'+:;9wuVrW.{I'HQfX#agrފf [[&)eVՌ 6IUSFu渑qnCb4yKxuDv)d7j_Ih-+5#2 Qe- :yrmpq h`..G4o5E9 gnJ1 CS=*ZqU_=Vy-P67i Vp3.AiJʛn=\A&9?uniΎO2ͯ6f5)L k})whRƍh{<!sۤ4泽!րv %"0yIH%R٠,.)vRj?Eܓ|8Dd9%1eHDpKKȀ6wUV6`GnpT Dw)-hJL r|Yeџp?wqb+N㪏̤TVI;5V `UK%`P h >?C2,Kv ~ᮥ%6Z|3]a;yokзZ&=i?:Rpհ;O4$4r%5|Y-s˩778nНc9cwI'֗;x3IL%9E g_=:eUʵ59㯔c:k%Bw(@u..An38ԫ "uAd{D(qQ#n)J Bawk_Uoc$1G:$[d6 gB}]Ȅޘ'۲Igp- HD86I{b pw|ԎEZtqr`ƝԝQ M $II͌W=϶ixpqIҥ阉EEx(8%#n[w K<#Ӑmՠ6u{cx',kFt5Li&:$$YMRBked8(Z;]QsNۆ|5{ #H?EhcI$* @|WLI&ɵ"'mdSCyF,  48Zf=:Hl&H1xi6i'/n菚k N%-ALj՘ntõw樌kEZ9ܥ@ﰗhОMJg?XKt;9I !dWO9n#\2OoHѓR{H<~q셸Φ~@"ב>zkDd70R5> % 9ʮOM";DO3Td'BcC ){@i1ݠHӑA Ӧj Y`IkO$` w 5ZxMh0n#Ffz(C/>A6\US7W$֟ԭ-Z<,APy`JU:4B+5*#MBt m}c76_a#MX8։ ](0 @`ai'tSKyHs =gJ]n Qlw)hli)k`BN-$)HI,uzkyh&u܇a/$ UW){Yt y{FJ=6?(<<[$ ISb OL Ch<#p$2{2u[u{\P^#|B mm$IA!Ѷ~hNe$c ѬzxoV~3Q~ʬ⫸fDp?4apVR + kvgpp$Tied2]RH7U>4c>3/|D\eJ7N@R jAjM[{Hl=I"#ڇf^M;t-btLM,jbKz5I;) ){DV>䴍D|l"Ec˘։ ,a~=BPlWSX6?aJu;M^0\V]xwQ U 'H<& uj6TU{sܭ7$x.C:Y[i.~1ZUk>8}.]>tZ*_acnv!yf[a,4+w \,خE"D$h>+t[xxfxbֻ@ay>ꏹU--z} l쟫٨;=\e2'p%}QfbH Zi? 8 %BwJo-)Z(A<JưrҒtuOMñVb)7Qޟ]$:I$fRI$_aWz5yz1KT%2-g1>ju~c.` nK?l0Ȗ?q1UàF*B)-J$LYQZG%)+Ɛq 6EF8kʈ ] a6#OKe6{zK±nnVmr[٪)J] YmA++ F(?Ef.l"VhyiWm%W2FmDQZݐvNL$!<{aV\8h9ZfM0B岴7JBv =r[^Ҭ1/#q L~Tw!WsȤuV~Ee+ !X(tFI sPAU(nV'>yP`Iwdu;+#K 뱤'6h *kxʛtPbOz(%7IV+S gD+. If]%Yez$Q" :Qr2f[N@N)zijqJ H)hqTejZ u? ^;9F RWxTWF'rJ)UѢB|*E Tp#e6JlFmp\wC\B$vkK.8NS3M$E $I' AJI$R %dI:QS`I*H I I2t$JRI$I$I$;2)e <(wV1G")ʅn T;םTTIZgP))`L% tRIe&I$HShҒJQ( $ I&:$SRU)$ BxI I$I:I)dI2dRN&I$I$I%)$I$IJI$L$I$$I$T Q))IID"I$i:B:+xPRAB*±-0҅QZ:`PSrJ]:`$I%)$LI$$I$I)I$t%))I$b1)JJRI$H JRdBbJ))I'Pr`$IRH$VI$&N%)$N$RNIIJI$:JRd$ТВI:b # N"9Q*LhЭWq:Utr5C. >>%af`"EQ2pzY[4ݱF -o0mNi*vz^@ yWu_ڏjmh7xY1&FPѨE!UF (nFd_qgF̼Kf51T2KiYu.zR ?Փr앴% t$MgG3rlfՆ8C @w4p@UX#Yj)҃x*RK5uZ\uYrpl!\Z`}U'C+%׎5@0jVe%ϬX| WSǸnc H^;I H!OpPI>.RJJ)R'L1I1I I$N:;晿[7#b僒׎XK[N~bcP| Il/;,Z~]0ci)֌}fcē;~΄픖@Zfw7]{%"t$R&}+%R<6\ ; ZaWl H'>4z)得 {yֹkRGt)KIK\LGGxT[qVd׺qo> aIO}JN?Uyn\%O" 0tr#CQ{J 9JXԒʊvyK,܏iT,sL1Q( >I;{D7QRS#k[<*f5< wװdy{e5M!/Q۴)%@OF)GHzc ⫾v *sL=5p $/cdry5H髏 'D iƉ)%*fVl⚲ns\t)a tqO?rgh~BJOC4}2ݭՃ"[=ι%F3LY;A0wgjyN *<;^V.7aב󜨺A}kxG&{h{'܈q֍?Ye7xh(7RI:vmI;Ovc?!"I%Ywig9 옴̎Rn 8$l&Tct?M .3GSX䘸aHK5)<5IH^FEmL- Ƽ fOƎ|Yg*&~> R@pG|ӂ3} g[N䷗(Xkg::iRDT՗jAVh;#KF5W\&p$R '~ t<RLK*u0Z;Y'!dOJ>Mm8gU7X[炂X[n0Tl:Ȟj}ܤy5$w N29aM@DKV۝itSnhISh1ukJJ@r5Т-UY+NԈq}-U`kѠB8.P!5ײ;s&_S!Ky %&Vs"hĻTHR28ZO'I(/cISE!hӻj+$ RL~hZôN %#wK@릿X|dK2lkKȤU`q8IՀa,O߸$/^Que#F Xu:#V絮hQqm=ch* ГXA<{gI"GsIuezn6 ^']]䂗vP-IX02G.ʃ^6=T[@4$̤w-dl4kyOf'[-& ?13lĩS jC-c:}j p<;$=oꆟG%ٱFFl %IpB$@ܩN )VXa:6R^vB ed; XfJvoa`ԅql|M;hݎy%gtVBVa\_o%cU'o;Qp 4. h|6om%#&&XJS$2*RI$I&IJI$$dI$JH)I'I%1:$I(;*ukBXX%u v -)&{.0k.m-.y}k=ؘg4.TO@",h*1ƆEc CtQv'@ehv~uul^}:Z]|ܰl/Q[4Y(fBT]Yjl3*@`kV_{C!܃쬓xsv6|ghvBn鷷"h5Tٖ>SzZOOЩE@p-T%Q{uJNm"5U Ɲ?Ymcqv  u{|TY(ׯ$Y8TvSO }%$m5G 6%A9'DŮuCpݯ'@N؏'MxI $Q ?5Fs wO5Tn6!CO'vN,#EKZe 㿂 mN?Pf_{xL2ׂgMD+&CO}5t%0 L"<]Eeԏ7 붸pN7HCs@:ƝQK)iJد!wb\uzD'YT)}WT7 2&T&6'Tc ĩ\iNtO^s7ˆ 5=ԅn~ƙ ,i483UGtn%8:jcCp#Yku $h5 86>VatFUICP.$L&)h+E \hP6=b{OsKCvMC~y) Hx‹ 8Ll?,s$ςcdPkL@$'n+z_#HI$0`ꂙS7vImnwƷiT,vYk*29PLǑIׄSTc%LuH*ﺧ] \2X #_ju Y 8(w\LP}O2,ƗDXQEQߴlhИ)/}!v_D8;y"7G)k)>d?[M"A'h<$l-IlFa0`ƨ'c{YBc :?߇hivݰ~ h2wBOޣk+6\\,p-$m=3Yl̥@WKqV(!i9Q)X"S ]Ī"B l%AUO*զByH(ҭJh5bTZHr)q RUX4P^Y lض7*VIAؤfJ0HHUN':J&r[8PP*jf)+A, `8H$e v2(i%8hDž?V-<%`RctE]I,%й=U OJ5= _EH >RrĶ"riJSBPP}GxATF PH5NAR*)V1) A9HLJ'NM Q$^JK5L(^(V7B`@6\TZ'% V)BJ *)!YAxNצsJ(6R 2RS 0 ӂ)ED$BOjP) N)!%))b$bTJҒXp%8H$%)$LI$R$IBe%Rt$I I$$1IJI$$TJRIBI$ $$%M(IKQNQv,IK)A!-{R$!a) )&*fQ]L%"I2HXJE@JIJN:d$I&I$RI$$JRI$iNTRRI$LtI:uNI$J2)RI:OABIA$BE;FII&IJI$ &rJRt()B*]$('RЂI2ImVtWqǦIHU ݚKCI*K.@!^p |Ba*U[73}0뻲ewוCs\$NSm?m44R AݵSJ'dD00gv/YDX]ƚ}ݥGۤ'`sO&mpR;C(?m$?I=ue4|xE;ih{5Џ&9v 4[^o!;jlcA')s-04…Nk m}܏PK׵̇k{j1@rZ-RhGFݥ=7SsV?U+1st?S[eDڝn0I)'-_`-Bƴ3k"Wk7l?@ȭ=ˀ1'OL哠 k[`=vD%=ͭH4_ӂ8@ %=SaNu#Pr^ckcQ&}(9NDOEpq"x:#}6͠ 'ee-NH;]I}?" ͎;vAL#n<%p FU}I|5^pA3Ў袷.0S40wl#EKmdnhrꣲkv1|yo5^c 9Pst?8G.ۧ A{U.u`1?mtC!H8 ?2!7) )о`70[S1u FJ- #^?5ƗODí@ׅ0CtSlu _rOXȭqU0{ F5ZITmDY( =ǂ0YS"a%Y fh s$k5U54wպIiVH0 #tȘeni:S;@r=_\q2 !O"]]m\lERipėEVku9K.~= 8 ?WT]ly{c[!q!+oz\`sD<G?B]5irusxi.6;W S۳n;tS$\>CwxhU{qnOe˟*#pЕӱdHq>L}SUp\CPv&F0mvw#l\KoPvS.$=Q;{X<»6,sG9O(4u4ys!Қ'NT]NmLAh'Ōw/Ѣd*;Ѱw4;;hDÀq)hw CPLN9IAc܋OSjs{eʞhMunGK nuj'=_rffcIB9msn%h.8']$xHWTxX]U!A^|-/w)ݕ._-./}Sdc[uڟAt>e#޸&X}eZ!ۦJGNj_hq"Pl_lTCu3:cN>wԵE-:i{ϴ/W%p5fi,kGZ8\qRtN}#Nhd0 }pCw՚ \onҗح] "xQ0{(q!g AFο Mv}7һZ#sD| f`䄽fx_2k~p9w \\9\QŴ~iK~]hz0!+SKo/lAr+аv)^;W`}ėtu[i0 GoA;5w $ rZ]^rj.3UPG3iACOX\5l~C+&$TluCv$<.^kĸ½O$"%[uzIlF>lio2zqk]qXeUaɨe}hŦ¡Zd貙֐.:e\5*d 4Fe@@pSmmI)Z=B.\;|9S-.w}'v@.Q o jofٞB + -+Sne"!+0 ]8- ( ;0 0DSp)мz{:$ِL< 3ƸS:!=DJ+a90tYPlRE,=\D?s@wSH?۔mč BW| hG*-51Qv`{ .O*V`pRه\=kayCŒLw A>a% cZL8m$*emi2cI #2\%Au{8pZmuAtT2a-ch-#"QP]]s'4$)qq⒕U0 l~ll4 <8 {P-H3BAvhHDF&n'D۪2nD 8;"WAm3CEmh'%@G!NhhJZD" >iy) {ĒfZQSdR_&T ;)ޛݡDa ˯tDk $uNkFр ID sF!y ä+uk 4 5Y TOP VT]ÝS:h`yQlnHcCѶ'ZA>(~Iۏ&4e7nEMi~OhCѯA 9SƮ. ^=K~[ΪF;G~)dn)1i,o~X&4ӣ|e9 dh;*A%%4&^p|z  ̂xN3q tcu ^wj٨`5+պNWLmt% 6ܗLK&+?f8=M8%$vRA ARR72i._/NjK1<u2j'|PSgT״aI&I!ЖlUMpuWe6HBe'hzlww!H'pƉ#v:(})20Cy &~M8E s=̋ۯTk>kk4<'/iSELx#ϒ[m8:FP}Ax&sTX1A"؂Jr4I!D]c&ZddN%ӧdn k(Wl?CkY{[Kk J->as@kŶX6?-m-,=wWkHzN){v0/g!%*vh?΀ fCY[ :5  lL8$,FahӅ*^C撙}vnAO!6tn@ʧ',վOF$~)ELs ))ƵyKgu*^qxS5d$m'h i&v!s'$Qw<Qζ渝D&Flf6Ga&\JG9kwD +G@EIΤ)Ѷ}Imࡽ`)v ypR7"]ܓ>F1 9(6][wd?Ll3UD7( CB-`s Nsv%$`Cs7aqⱃsKTY]{ ='} ~P~%p:$sf>Njsi|"R{N5Bxp Øt1x*niiAms,yA](ޥr\V :Z[uNmN'l IIveA{u1J[mD;J6kDrBK=-㼲IxY8/ǂs=:E%vrJ`!RE87$T i: Q[N^>R{8O%KROՐ}D.puPs+JAhU[[%Ϋo3OTlF mxf )7-nAwn!]jEvbMRjΨ3#Uikx"4Oi®KL[lkp:=3䪗:<np{Z#Ь77_9PRqTHaӾ;IH kvn0w dn%1sV vHup5FןXothr>) l}@XZJ BCw`*1c"u6KtvVp.m{YqU8_һ hnjt)q hhV=Fxpx>6Y!d&JRRI:I&I)IJI$LILdI%c׸5C;h 4=HT}`)[h^qsˎ69t~vI[~fDzD@MovK6;hJܤL53X6K'&S>yJvBh4MR=9J#>cC]?T~jxumH{h O '9L,'-c\u+xß&LcOMsO*mc7yhk!\N"tUI _EǨ 3!D0ơJwi6+qv{|pJhA1]Ëf "4Iwo#C|nxHEJ=w`ƩA8HS8׷sG/ \O5ڟjHׯ pq8 x1iP~0,PٔC"˿u@NAy?-$`0~)f۬?N"[p$lGʓ\/nõ6L^#]^lӵãݹ[ ;"c6WrK`4wm{H5Hܢ'ϲLf{Jhbhynq  }Gs_>CT e+&X4Oh72{ALhims?x$wrX>ؓԿjTLƇ-(UH~ꏴr{ctX" )'9D#O%#д%Ӑ`$'>'G hRC{tL<(]5n YDCv M D2!$ױH4Gb~qRS(ȩл3kȱH`w [ЍPNH&g 5B "i[i6k/HʵౣFOwx8l%R~E TKLS,vF<>RHnF[m${D7^e% E:!=s6iquQT=N=cY__s#iQ|".S}Jw7'HS;! h]!Ypq> h@דH\縁nKS'UYh;@:;ρhWMxᴞA;4QNI %ی8IIM:k7G 5Isت{[Uߵ_r#A4uRCa&5 !jsFIyl j6`|&xN(SaAʌC撒!l;X:OP̱-TM#o770vVOOcAnS瓪)jٵ3vOM%U@V؍5Gѩ'T:98|ӵ%5]ۀ X ~ eռ0{!+&k]ʓ?BJOe,Փ4vHfXѰl&ݧi {D@CTXlpygVg ޣC})={"uw*-1$V Dp:K"."i5i0󢕌skGRtt) ݡGꚞ5ȥc(c̡H=r2THȤ@vKX kZl׻~J{~Jd;>a?YOJ5y1zM[t`=&EZ\ "">L-  2I(׷I%_aWw+yw}2 CE#'VnWZK7'(:t(jUBT^$-7;E0rhy9/Wqk%hZ MA]e67auZS>1HD~]vݲV=='Ԙu"OB) dJ  q[dEdFVy(ƝW0ڥbUKD1ΐ]q# EqQnЇK{JGD@>7eYT B5NBj4vB7- hTT͚d:Bu-;#e5Z' VxSBHنK%XʪUG0gXV(Рmj@VUnJu@4-w6p  7(=KT@s`6L0QW<"v"j4X N-֘چ ZV IjP\]g2T "4k+4ꌅN^GW'8r*q*LJrT A|S5MJ' ؊PIn6r (^ EpB:&SqL *)h%`/V̽Ac5Ls6UZ 0Oz>S(XsDr&*(d铤\$$BxI%6\#I BhRQR.H=BT%%**~m@rvkmLX.DAVjpALSRT% $J)IA:d\$ )3DHnAɁIVJP%2TR)dI$%)$I(JRRI(M )A N$ВtҒLIBtNI($IE$BJRt&IPL HR$.$Q*ED'LE8rI%)$SO SIKBJIJP$$PTI2PARI$SL)t '&qPxI:$P<)'I9)&LI'I2E%)$JRL%)$I$iIJI$HI$IJI$I$%)$LJrr )t铢P6蒖)$0(j\))dHJiRIH:PJRR$"L$\RRBt2)% {.ǢWpNQ4xSDP%K.녥80ʹSKtyWUve/;O8'Q 6QxڄՇ{Rc׻s,Ơ̋.8uuMS鴰6XNO|B\UHuJPB&D8=O)K, !)euiGG16HX ਗ਼ã~iĴxY`zo˽8rc2>?Ett"[A`$x3M9)i;=ʱ=Yx1qL_p%x۟(N{YRkṰG'&HTm:RCznmATǺls^ k?Bhvǝ'ܛ+d&sdGpyL8xNwD /;~D-B_py XnC59՚0O(v7zdÁˇ(y<ct)631 >A=* Mey- X[[߰8!YX7fD 5F9?A@t*mx]``LG;KmlZښ'Z"侗:)0[wMF+ ;w}(>1.,q)4(#NSa]{릅5Mzĸ8ݢ!l5l\oJ.V%4S :$7Su0{aӥv!R0ƾkwGHūyv N}-s&HCu~9$Z~ѯ%5 `kxx(V,RRzF ib%)#I{EpK҆5;&%{XN~A #I-! TtP&]:Ɗ <"iP,#`(ͯhGͦZ\ MR"%0ӦTAhm`ZuU#]Uø;HRlo'?%Wc.F%9%1pL(=HJT:vƲ!M|;\H$puhY,{hdi)$'D p^6 1s_JeXsUM H: 0tRI3S ?rJLcZ%,1y)*ZFD`1H<n{ 8\tR{ȄRR}m?(eMNח Щ9KH,-H%3샶5IDMk:M@%<|oQo%N?58tX̀=ABԒ͍{H<!Zmsv!Ǒ Lkqv6މ=ЋAu WPYMn )nh6?W}G*=.5b6zO."c- 0O!8/w@ӄ86 tD)w#C%mgGy)Pv`x5uxC+k@ DvR?KO4c^)m2$+;6.'X#C6ZGA'\XGv0Gdcuf\pAN^N$0sC<|ѹȖkG_䡷! 6fh}8`%0x6JK-:HKA(߈0㡏jO< iIoxvxDxHXXZ.۩@=.Xt3Gqh!3H2< 'pR/x< [EI䒗T{io'm8uC]]YUunִX8C3ك<1!MGI ݾ1K/-7ѦbhAk|(o3>inh2G YunDRhnO%VZI D4hQs` 47NʡŔ8 U5<%ݽt@Rn#cm:sQx,:qRuZ ۄGy'VMALwO=';y>XK.{z5>&d :r"'PeOkkԝRRZr˧OvnFH.i b?U81m`~Iku*[yLJn׌1 -;2ZLL'_%?}6URF"8T eDΠ3ɃJIX:g8}h<^D** O<FӧkjS,b̽#)mppO?CԹ>=.CesPk:$|O$e#]쭾]?uN`A!#!652 ;vfO2WI)a{ RS&X.- 4x)3o-ktFX^`NQ= IeU'qwAF^n/!6j$W!:Gx]>JT9'OZ1kI 44 \LAM kZIZ= *cq;I k_=8JGTZӼ *!xRá%+*N׈(]W!=wꢜ{\DY"H'd^ù;΀Ol;Iʈ$>dmDOSwFQkP[^K8vQ^4 )L]wZ4H4I^ )3q\< Z6 ΒE^.tw&]bJQ:@%&P2JJHmtې熵 i#V/+i T$>=n{yh2MuEg絬9(Ufuqeo<;\#L\ǸN!8LJJf*5t59{ A^I*iKvBghZCZyKшq"Et )eՐGcwfVkƒLYT9p"jYOSQkHPٻ)r{ni/GomCgT'v[K*>p}(qԁ 'NRS*|$Q'_mW@0GA ݹ"GT :"zr~ Yߤ%jg_mh:6Zd1V;s`&%ܨ &Pb?kdg*^"@'nͱpʶsxO'^BwM;i"F}ch|c8{v, LCb )*mĩg<[vq?Gˉ6SQv9-.u%"yP>(F<-:})lH0'B7^[ 'ZfsD:np-` 1> :uR >IRHe5\JkDwW[@ 50CcvA)Zʓ`'@O 3 )vۊtJ0v\Sn3U9m=9tm-4ƯA'kF̔B.%*Ro4}sƀpM6~jmLhlhk|^&a$ 0@kǚHUn}\8oYf%ځ!-'I4_&$G : iM3I?~yJ},,h22&@h6Mm, }?]4/#<x'h68@*VU )iY.yuk:}vwvjn%n.q6i+scdIvDccC$@N(zB6?9 vѬ -Wnǣs$N8y{m aɯxٰ7wSݺΊVZ$ )%5fkb@ ;@-ō:@r5tsN 4\FM"AO%?ѝ7iqirJKfX{ >™}-qkc[C 68!f#*n^ڸׇUH;cB $%OyhIP.%"b ھG}V&ZVi܆q`:i6]4^ NDlI,ogT74̻wf[.1D~5Jg]xR- j]ɯc_ML3w-Ӎz%O@S$=,8KRR߰idgݪwg\w?4C2<vmuIOi`7úI><;)򒖩ݍ$'Z..ApojX4VRat#P{Xk<8*M'oV=IIL-d}\?@d )(&k5?Lot79p?*Fey%&j$u-eZs}'ziGkli4? WsКQRCc"9߱L rYY<+>M 1Kzc_@k2bNI4;p2)V֞OcٱƑ"G\h cFb YO 羡K۶f!h3q䨵۟H(5<ݡ'.t;Jgu~1h ȵk' 5ݡ?Kj:e tP6}IGҋL{GHT7h`/KuF;3+ "Z8!qJ=O."`;^$8OK?CIqdR·m-v@,dKXMR{*mxp >ڤ_D|61)KdsPS h+<ht{{r%npQ9!Dc~׎DTO;&5vI3q:N-`s}meqwc02H4+H&PR[`AO:%&d5l1'!o$M sKlDr4¡Y=. DpѼ{i1=}o}Q-¸U0}˞m {nAfpkqiP[X}7krcpR\Ծ3C 7Eҥ)$)d$S$HRI$+6И .I68XT StΝA.چVU60A#k\[?f3Br2{Q}PL->OpKT cNT"T >2T vH `9 5E-iZ|S㵣1i&yshS'8loaűm\=mU Sod:'s[& ǺXZvLLb<(SmIq Dy5C4&ԙMuQR'l4hݨYk\w1LJCvut 䡵 l3$*[:py"8L 7)mar qkI2<B}8LZ4:G(W;"ۧsKN$e^|Sz w%UZZwy(6ޕ->#pf~I5ӯ!Ix0S`=ZC\[yZ\qROgV c*W t$N?|RS:l5w>}:reޣ}?IZL}EhIxF;!A D PR ,=Ç7U{K_=${ C7o.U,Ė w?:y'tNޚOa'&~=Bg@isO{GqFN>Ec ٵO?(ZC+sFR {#FSn"$k%!I3 ]}ZHj5-y0toE8má3x5%9x]$uj$m>*6f8 D,K^YXU&!/Gq\nN "#?c 4jLd3 ;v&ksN$jjNp.~j ct%4F2YO׺b>i)ME7Z ;)c28ܧ:NH/ݏPnΩ}cV1`=C̑K&C;0l'WBcAX-ik]9NƎ`31u)n$%0 ӓlK"9&9G|tw%cc!өqտRs0ixLLhOȤ" Zhf?8j \{'m{ǵyTs].Ѡ F)0CLRiqd" -MVEghQcnsI s]C{Ow螏rd홓ÿrIFUt{[-aЎI(!{8(:ku yFDD?g`=`&4YlĎw(XDdΝy2͑t t;j&|RRpDKLB!%ZxhIwfVgn]tѫyӐ_fO Rfur j:\ݶr3Vs6bdhPik=1_wӿ' 5H!In|-Vth?ԍ1 B,x$  (;_тf@sxYl"׃ƈu y< xBa9|h=ɬw*dux*[ QJ D& $yr1If1c412 D9/p3ۅ)<x0kSp#Fjb[{ ed4"tP 2L0crge嚔Qֻ~yG`5JgtlqH猪Ew<"uD̘)vR; ̑<cS!%`HK[)KɘNo|eF jEs_+'tB%iU^ì9yE6Z[{w)=2x#*pRrLZ增榳n6 )c7Tcj6Aze9 I4T͎mG}hH*m_@s ַۜgkL%P*z;iqБcPSe5K4{2WTHx @>*^CpԴ&sø R?y㺰*t#a*q\<8 uwӀg^o ϒp{|+;xT{g\턆'ICmo>K}bwZ4$U=twI kA x+g&Ww+dq8F1/OI-={@uzCn mMmv վc[I2I(׺ $_aWw+yz72-g1>rOV[ “mRh\4ܢL R"^յB745 z TqBU":*ށ]z*T`Z]EqP:]*G|TZn%]sa5Dr|dDjT.~&@.$#UR(54S/@ < * #;T'&>1J bEp[l~UrZ+4*FV%PnZp[ >hVǹOj" jkke[FtR֭Ή2EYiG!!k(0,iMBQX1Q*(UlaSudtY^BGzP oV#+"EX۪݀ JCڏKuD*f0Ur+[vu}鶦ښiZ TN\ L•3@hɔOVVDQPe@5F1RC(Wq Dw 0TE2+ P n(k< `5>Tj0z5%f1>0BX(Ĩr0$I$RI2xN'IJI$F!"֒B%A(*WVA1H&)ނQ%%$BH I$'L$$LI%)$L$R$A:d)dI2RL$LI*L$0:S7IERIY:du:d&I$$I$IJI$L2HRI'I$IJI$ɒI%!(XM)8LA)I I$Ҝ8 )I$pTP0LSR JiLI(Jab $c`JRRII2JRI$(L$$IBRLRRI$QH 5"T)UAJ$A$HLI$$I$JRI$-I$'LԶ$I2J&ڦJ])Ljg,%.d )I$I' m DhI*L2xI:dIk^`\ < >f: -vDOVx*-|ȏ;?;HDDҥv=$+.ݯ~ruGJoqqvIGO5K4cQ[fc1p}IXfEdϩ?9}IԎSmߘLN[O{Ot+}/GuykƺUc'LHe*k~<e["HZS- ^=w'!g\9̀e~@(ԉҴ?9Z܇܍ɸ6nO}ggG>*ָmo # =ڢ>]Yx6}͏9eY$^֝IJ-lX^X>S}wdO~ɽbDݠiMB,0_( ! =Hty!}J~H/.h6X6};=V8IhѰ?P-g5t"5X_^}ԅ l64\ lGi 8˾FCRhpպ;R{<$g"+vGa>}{@4/kmNя*jko$8}6"4t#GXCxvH]ֶi5UJpyqoux{č@vþ@$y(ɐ53#,CpGW8X,(cK^k;vij\5ODZA3)rJl:0Va׃PlAUqb0]LɅiGtvLw#Ʋ7m)쵰KZӐ?r1Yo@j"7%cv*l=l56D Gܤ^B` cqR{I̐MϦG}#(e[n;Qwn5gxLwEq1Dǂ*ntۜvΏN{@?A1J,Hpk߲Z5%ɀtI0֔CTah,p.&D}?wmc=*W != }!f9?N <ʋ +Ja]olyJTzﱍ:exH? ! y AD\Ϣu)nsM;![ꎀE+k]Uٵ\31zxqfQN9*6T'YIIiN<Э!5 s][h '6k]NƩBMhޓ*A"QK*A> sv+w:#wdԟ%< Hj)HZVHj&;h<e5IC;b}3V0S#akHIL1I%ޫuS(t}ͺ-cw."?ՊBROKk :*ƶGL=u2`m7gWKN<$ R /lm5.v\5I<:~hnPc$-d '9$;REnxGm.hIWrq1"p]~a_)C>ti39'mΤy*lvB9Rgw @1{;AMT\* TZtmCDy hY@@sq KKiǁB6>}Ek;IH[찈*v3wD?TYP!ӧlgxA<)0GjMl#RR||~hKݬi>5U[e+-v[gv)^;ji%%+'`sN8}Inx%,;A2~N|@LӪJIUaÑ̪/{a7s^>FCIRzDV"ILr$mg$A-i[NX|lȀ<{'ESTg,"3"7Jl5^qn?/\M`@ʋln,6o9}D~9ۘG0lʳMOݤ qg(m)6 Q N-aJ*J.)"#Y짉`$yAT F%44C{9w :Əp3)Vé kqI3=Skɥo)Ӛ79}L|6ZJ~2;kƉ$j@w:'pD'%뤴]r]c: یTSl@sLxBL{=#;kj}MX+xb|$~ܷp'voR C#\ѩt /2t=w{q FS'kX[ %<1O`5~ƼG(ciL@ (hqMƭX%ki0`u!ڛ *e^C:=Kgq*N_$:#,k=T׮ۀic@pxB_I̖9;"Rˢ5?J&Y&KOmL*m$[ˆRA^1 s[`"3wഉBckhh')8cȆD\Vu'w Pl4jI$5=Se7#AS{ a?8Dy}ց۹'ZhĴG,E:Gc iD;{j3Պ樓um-aT1"e!a<6|A/))Ș|4]m~3T*޸Q^DL'O꧱;Aau/p""JG0o[\/g Ґ%Mv\Fӡ~X @$1{tZ|R J.P²̻\Ƃ`O1MĻgK{kPcb ρL[N)SKzLSIcB<ʪFiטt8?Wou1or+#l$pcAY nj5;xBvmq%AB^!$XiwcUMX"ySp II|#ͤϚEIrlvk$<7Y5 fu[NZ2t.tOR]O(24  )9hxZ׬ZHUd:Oe(okQd::ORf&ƍѹmuA?GkǨþRڂW=ۋ{pס-;>Ʌ0K؃,jq&L|]Xd*L{HxD$G,lG"WNˋG!G"0=FSeN50#耂ʅ|).ײg<P|S{'5RO4(V txVF=;ڊʢDC 4Cӯ׎ˋ:H*c x6DZ ;$pOއ$$5WXnm 9ؑ ̑==VKƗ3Ib{wR+asiQ\%5c@h XnHd6Gt!@U(H v#Pf<(:nPSg<\ߺ8RO.*`؟Qߝ ca)K65>HzʤrXOQ!dYHwV}Hy2 3V%_x!3s_y":LE·ϔ7mm-M1\ګљ]{C^`{\{ߠVd9D&-&'XH~ns'(Bc۹;*%ngy+1h\@} 3(D;vImf4 ʻ[줗cJllÈ#fawI&T6T'R> e>o<;0?A48A:Uv_Xs'vAwѕozLI}*lH'B`L;BI)vN=rB.76+Ii{ZP.c[vv\Iòk+sڣ]#55ԍ2On }9srzv}?sCl G ^Zutq~KemǕJ@uCōXZO FXַSuC8X.[B{Ce-̂O(cւT]D "!m Б.Rmkc!Ý9{D(M7F:#wII%jml6l.'󼿒HHqZWc iwʋweWcAtME3$OZZ\{nPNH:1o.Z5kHBg='ĉП;֍; HU@O M'[lAc<"Y{Ŵ89w;̵pNpnySX'HM$Tp$o2Smky塴 ,փ %TpДm0yF<=Fư8 nkRLvA)b׎ͦOsc]swHuc?i6GRs `"FԤǦdٵC(ixyC|5C`{YQYkv?9oIx^qϒa]b7Evf(5OnΒk $7:I-p1ݻ8<)Qg⒘ߐl{\`EGdU w#%#QU`Cd)fCQ^I>&t,a jؔF.=SVmuDSc1ᡳc1Jʭ׹!]?\_s\ښ5x 7= X}AT]$+ R?> m{ۤTҝi?Y:Y>{g1vrs!&N>Њ}8!Vc›Xg;GRk]ʵjshSq#i?5(hoPpEj|CZkp=p$A/uNDƬVp=&X+or^>Ro~C| v{!E{L< 75xAO KZk#fd \㴰Τjr1hm`W94:<ӝ1XN}3##dU.4-3r ~5ݔlGof]Uvlx>U*jΝ cީ\d 4,80TfuR r 3Me1q5) akf` ;e\#pP{xQwI<;p#P{)S^=E}|,wU鹶KHpAۄF`$wQ"GO3Q/#X쒗a{F6?3"F mxuޤ <('AQ0\!=>i)Yi!hCXwXw(+.fT斑5/v8%!$k_M%9%(1qkDl~=Էe we׏?9#iGu>$pHSۚP'۷CК=w:ςt'5vTKh#$X`K+DQYZѰn')=_o\#THsj#@&TÁ3ƾH+^3Kד Qd-p]Xl{|Q*p;$)v0<Eն6ǎH4Sc 4Vlo<^߈Bc7 ֱ8XusO_7|>#)q5))Iw[>A=0fv>x1mM-sIژ;{|S8vP5dx>%.X9'M˙O9ŗv:;ݰ0qH4DJFГZmG1zuU۫9)kuz 1& 3Tmk"qi!wwUݓX%#t3hxsNJqigN^| p Mk]1r:R=8A/& Vzi7/f  ms>'<j;ѩI q}7 H)͵VJ qHѻ< q){٤T77[H䢳z-0KYa p&]Bv;'t>2584~ 60svQ9mʺf̈́s^y77:8C}_ӱ@I$kI_aWWb<ʽTHȌ_S4E+aeflr b}p!JR5=DiiPLL&/B[@JZtwT+g>5IZN3b~uDC{.6J:5.cxD4,gӱVݙPVQJdN .\u]ywxtsQvNѢr$(1rB7Tt8;k Vk{XE 8,0,QoIA#!9uU~Tf %X*BZ[գ^HV[UV쐫\;c0n; S"t5cܢ R M2J-\!\%TwjY'ꚓDJfHVYwI$ cbJ-/it˗9UJӧ0vK`.Kq-^u[,L$.솊.nny#X~KUDWJd^Kv,\h D9@ U!;@tcɳ'E0v'$bS`hb3S9 l T;܈J+իu4BQU"䰐 [tL%L55(%H?j, |(4"AݠN肒ʵG)FsYlZVyN]tK՟dZ${$I':IIJH)dI:-h(դ)(A-I%pg%`WV IEf$KB'I:I$VI$O:&I)$I2t)t$I$II%)$NH'LT[ʓ))t铣vP*CXI$u I'I$J'LI$I&NRRNt$$I$I)I$Q% Jd 1O*%$.2u&JY$II$I$I'RRI"S&S-Q!%):iIE@MD3YI.IJA*i$$Id$$NM 򒔝2t`eLZQ%$$&R)ܨ5ԖdLҝ'Q I%dI$IJI$LSI&I$RI$I$I$I%)$IAjIJN'AI9IIڏ-tApRel:}kCVBlH!Z*#ciaT9C[`AQk+}㸸#ڱXO6U68A"=Wڜ$4ik✴u %ݴ = UW\uҫ@t3?EYm^0gL`x9BylvRꋷiG٘8dLD{S `7udApV 1햙i`]Eaտ#ҾFݶwm%*w%ӷ`?͞4L,i~>1/n4R TMoARd<\}v̵pP=\[ ّsK3M=D7Q !+jOLpBJe^`'q'gsA}0W96&`an:S;зB;v(b" vB,$mXѵ>pkpfzn.oV;V}7&~gc߱P5o9i;fcLxԿ }&A :=4"]G[-?EʆF?kK UtGO'Rky"Aañww6znu/;~B`~[Jo30DB:ǺQ wIHC,:htDðݻwjUx<G-'?ȴ`fݰd1Ow8rOYֶ&~! ~ծ#SAk`H-vq}O;ˠp'lt%&ssBi i)~d{%Omj?na u<I@kI|Oh%;5s< d4)Ad\[\'YzZǰAs\f/V^cAa<5-;O'Σ%]=xCAKzcMߘYcvx~D8~G 6=*AsG=L`HPu GiTA'49oH%3n)sqUjY>!OsXK9]4q6iGiNh3N- ` N$u7etj6u pojae϶6CQpZ?:5YѡPiv?;ú{(OkKT;j \͝K{ƵʪO\bNqbe.Tw7bvյB<q~QJ,_nFQ&jsL1\N3-!`YMQu]3OD/R>RIj?RI#G4)Տ{XdJŔEqxOkS;AIrAk,A$+0Pѧ$-:{ĴO'yvV42[c0c]ߛ?b)nKkxR;C@$!Wyܨ[Mdkj涀eL#r=+ZmsnM>jMs(BHsEL硬@!EWn rNGT7DAo9VǹW [0:?ϥcuNf:G Cml-;t#± nwS?&҈}rC !mE'V\߯pg$ )j2el_Oo Q ' k*q%<=DFq{{OT7f-w*GSZDy$u+0H-5bX4<{qc_5&5oAGoh4°Q2k1ōM0LΠw<0ciL\!IJ:2Io()lxmW+ c2 T6I!NlAO!h'D(˴<8%o[ vƒcL~lYUcHLGmmFC^AM:f%GRuHC}6KOnSݻ&$}񣣟{k$cwoEI hR{K[DBvhӦ=ghG:'l@EI (9gdRV"Ƙ1Wj쬹GȬV25@6cw'ȣ5)ˋpo "$5udZp:n1O3)uH'*Uukl;H0 *GJfqK c^7OJkoǒ9%=beOx 7ѹۣ~$#cz|OBwO<>sx~ k$Z2JD Sc"}nִiVs@wW 'X#O wc\@A#NAMaem ki;;* ȲI =Ssjqsݵ%CsktH9lZ J>=ehq 왖aѿa.!:ceh`l7:'XX7hG0t ǿN}l7\%63Fv3r\kcPI՗?a$u5#ǿ YF\9JJJ]2 ?k5$$?@"Z^TF&IBH}IR.pBLiDŽvX%վk==Cf3]{j@w~ru mG)zǸdHՒ-J=@p ;GvoέĂƆ5YAm`no*f;kf5'H1LܴKpyuɈ%&{ks}I$(BvZ{?HV41*UѱuΤ)%5C +SnSN@Ε;h]J۟hcAG)1'˺&eEy 4ʾ[kh&dd4P]D]V_XakF?rc+ shZEaE@oDXN}}Mp\t1Z9n$ bAIGc#iPtK["tSpb羖18J;\l#\kO:8=Isr 8&S5GdZ 'τOiMqvIHmʶ8I9DZ95 $0L;LT*a i%,:h&h~78SvIIvָDHjMԽ#]{$jKjqD>k䝖 =?`lhAHew߻Lڊ!vT-~/Z͓ȣW97<۝|?Ehܠjf#N•mAEMyoN{.ЇH͸ .]& ֞9O5A4N3%!\C3^[0+}W 3c\% (f\DȞ"| {OD9OH)ΠTb\}fg>KN=}Esm:UlKlk۷b'_H0C}.0%2w ;.&c%k=MSP-y#VoU"2vC] ;D)<|QS@>lh}-;&ќnXG8)5OxjUM<8{}NНR`xwMGeoGlw鸓K0}TBځSc 4R픔ܱͨ=u [*hv< O"qg;@cZ/&͠hL4%Y{?FavQdPS'U2dH(؟ʠm 3X5$?trsq4zՖI/0KajM$L9|9I*ȡcWR>o1e0NhF?!l9fՌZp~0]D<'=A1wIMic^\O͈f.p0bSV؁ @g9\zK>@%/B7myas[R,%<ѷiH?&t~Ip#c2Mw[`JD`k3*MXuJ*G]ts{4QI; y<7*] -F;C!X`[> q?G3 |{&ui-0_ckd܇5\X0^68:V}ۈĜ ʢ"%;˚aygĶ]WE6ZƟAemc^\ٿAjc\;0+i$65ɈebH|uL(`Gv*\#n zmyyahRv}Ѭ=h&FGo. \6A kAiMT;`J[]3ۏ{ACC˅gFk#jg#k*, 55vS8wa{Ol xx#l.%芕N=F7HlxVYnshW"^8XF3꘎y8'OU <@뉲,g t1l$jTl)-ʔ4!CoG,߸)M..:sh l9@[QsgpxIh;<;gYKO5%S>\tN8FwR5;`PRyZx?Pݓ~raeց T\\SJ[앗nw2A4%uXsCX mմ湰֟jzm&6*^aoKMtV*hqi2?Mxmvt˴_wu!V6+h1k{ c P" ~jC4  AMvsA X6-R w <ŸsI}jō eTP qk));jm;o}X^z-=Tډ8IVqel-5Gg?Oes״K;%kd0߲*CZ ) m:? >˞[[ܥ{[ThcRk{wV1۔&$3ecA♠0ˎu)Yh{AHFmy sS2 ?F?kݕ(ct!&"4x?MU۠ڑ!͓Yk=S< 7V6?:[۱Ćl-݌rMO;%ゆK'"4IT $>2OM)e_%N}WDUm~>C+jroR5=џ v8;ВSd> $Gљ ek?k̕:,uU;/M&Z @]4J!XG1,p!f 65p=8sܖ~l%\a9Lk:uRkmr>8 롥43۝3?֠Y~N=?u76t]8As\4I)kFK2=!&G%:]KO!0r}Y~i3Sƶ_9߬v?QmĘK'k7y$\q=! %NyX8VdYSZ4lK]UlwD@ʯihȶ7v'_x{%ta 4t?f9Vv&&/-kuIֆ}-iъ{ْK놀'aИuMNMV@Asn4cNg8NJ'9cwmWVa||8 \I=͌ݨy$͵~nF-9E+/#{^@9?B׊HkOZ` *`st3K::DӢZWd84Nz1X#%߽{kem0uZs<<7;eczvC46y9eY -[k}2K+*cLi-lh7XIۆ'i%s sha|kOIKTKo?*Li&W1=hX[jݍ˱I&L_O^l9 <]w}j^_/y>h^`z_FSJN'3"opf7_%:\:b9Pitx)vGM93)8~ I?-UC i&5C|;_ Z_N"8EM&d" Ru! Ǐ$ypqx|jx'DG:w =Ӹ˲Lˠv%$0aa}7ljOaK>-46cˉOϕ\5[?4IH,t ?DmԴo">1\Fəܛ ]@>LyG:5n(;i"I({th!U^cqBS/phc) uL7j~IYi|ѷsQSa~DL_&m>fpG#!e313nцOxMJ tuWʚ9]nSitJ!Z?C~15wV1(U8t/-'D9>'7nCϸKq %Yf\%w˙510Ey{ۯ#GyILcExi?KKk q4rj1=@XD@E;18?ăDtB& vID$V`vGmTm5{[zew:Ȁ \%HvȑZTΌ@>gr>;ʈm`zGƎT-~4.0#Vö0 3J %6{ɛ~ :EARad>ti!ח6^e;},YXi'Bk|;g*AfxIi)nAd}ߚ Cg!:R665o4y 58 9Vn{mipS{y-%BpQk4: y$ ?8}/%3l2{%o\E'V4> pԜb*?Jf3RhOo9R5Qy& 3442C2{tNVk " pS 7;"Ѹ:4IlNfn`2~ )]t: "cY{ЎQXeˣYՊw͌q ܔ9:nrNT E-id&:FֲOΡ]hCi ,n󑝹"QO77p>S_S qQ=*Mq፞T?CaO/7mjK:QhIN>LIJ,`6ȷ̝ޓC+h8 56F vRe5xӏM1> Dt@0'#Tէ&0H:xOb iaQH!}"`&kAynI spm\an81.)l3oA=wl7G$nݽ1Ko~no.<'+۶X^7K/Z*p*knIqS6:H>侑Pf3& AFzmHwfMvPT~樂j5u?p氀!sHݨII]]h WU kN&/k;t/\Ig]7t!HUnQiiv@AI騰ztƤN{&I~r&$XZLAQZ[3!zӤK5Y<*B 02 G 5?E[ 5wn =83n~U_<W|׹Z&y}{$0aߕYd?Ws;=6W[t`DI|Elie ~)ztvs)$bA$__aWTX~UNJ?aC"1GLO\X{|\vO]裴'ګE#pUZKPs0l6%c#"siB}jP=)2 "H"Jsu+P6ꥹh+O(T. Uh4ܧ:d};G X*A1-tYR5`+gg2а{zPnJhnRVvlGOF&$,uobl(2\KubeEg(aN*/U:]Ȅ!\`WX$&0 k8,;Fh$KR-0g)V /t.KjN[T9IjF+:*rpY%C¶/l+-2pU~<&5C.eZ{,*/n#UdB{ UiGu7\lwuV"V^ a Rp(q ÐvGU88;H=%g\J#D'P ,90zNtëCd#TepSS9$bw'2O)E Q=ꁹ&2F}TK\Ȅ1ʯ]lO*@AG >UyP)!4ALKezg GTtACV(> 9wa]U1E $5I$$$Ja:O()dNZ -E$(IDxN$‹SvT*۸UJ+5!Q`& KWLJI$I*L2I$JRI$b1IEI'I$BI$$JRI$))I*L2(JtjFPsa$u)4ʀR I$)$RLE%)2t$A%)$LIKI$I)I$I$JRI$B0g )I$qOV I$GbBIEbdI2JY:I'Dbt$b].)˔ ID:I$JRI$dRI$JRI$2䔤2A0*)1L*M1{d,Ҷ1-7cLmDuB:YixUBpԩI:I$I$I$$IN%)$I$IJI$I$RI$bJRtp)$.I0SBI%t$]Bj'ok|}Pc )R~gkcwvU9yOT'PH<&49d{FPѤ8;`0avBGcsmvTu ̧i: B-mF ;64Ih!! HFʷ:? Etvw~ T3{-5ѧ'`˻ʥ!hLBgh!f&iIjD)ݭÛTq7em`qi%UN=*8mvՎOKŏiy:}T6e_#s<|+; AR6: j0hNQ,arտ]T,o)<3Ֆ e¦̏s{ʓ'Oe<'JlNF̐4wbq ~k#fvZio5F{XZ[ !l5RdI2HS]29Cjnm̵G%ll VWk̬5ۛ3TlL?pNDOUmuVPqv托q`sfI-8ks6>eg<?r#x(Ѳ&;!1` JUTfꛩT='{uH#NmnYWKopMHp|Bgtx$q5O[EN6Z ~j>1h/YЁ~7}EivbAA? }4'Å/A#b[&\1pa$8#ޫdTCncOC3#wr+t>I`>N=?$s5CJ󿖕nkhwSPx?K"ql~\ y75g𒚆-df@u#_ZLeRX0]X=PG8xݶ@'%fߠt>|!saO<RE\ gv~6MqhUTKOѱOu*ߊ}0}5Dzk$wS{h|9 =.Q9$M?Oư8mju5E qgK?ja[|Nj88Mk@ 4;!7 /ѮI/x)YcÝc v]5v/Qѷ@t83Vg8wUI 7wT`m{\Y}Q??=C3 05ڀGp Éӷ2 N}?\+s^3{w1-w.>Fu`3jEk?EXhsLzDE6ͺ Audq,k~AMR$~{*~^ָ=Sʿ^ Ndeh׳^?BIu^Z|[&L#5}\:KgÍ5A|aem#Vk(Zƴzg]&yh<|7R#'y.o; hD0IK۞&]m;=w }n-~oޝ4 i˄)154D644!6ak8{Qg"!&}Z\[A,V/sF\w^RyBf4JjUk@"R=Jc"dXѽqS4A|~iiV{p~%Ց';F*^Y.yѩoO?-FHw Qk}SǂSl #S*$nl1!SA?N?Xm6ni{|?90VmGhQҳ{DAͱ2͑ MA&E-v)[ 6ozhlxtr0ͬdޣd Qj!$SF-:#AI?rJk=,jyo[`%PFm; ]> HIK#(GI}N$w .y#QsKFJGځ>wnKZKqX^K=1SݲCN-ǥ0ci HVgR`x1<4Ӯc@+7"=e3hnqniYS5auLlSIIMlW:k϶TS #iRj'9GǼv5`ο`w}yDH&>"X>76i-;\?5:tFyMdx;J6C_\LA$CSp)I)9%76\ja`?9M]am)oHu\C~)uq^>>*[ CT9A9qi .jRhGo!6P9{`<E ׍x8IrioOgOWOx4; <)4}%^I.k@cj&1s@N5%d%ʉn$q m7osR۸-.ʟڬ.w2 jf6#V|TK;wQ776ʉ*LA*mNTE+vF`\D6b|?G|BFtA#\?;@R :;ĩzmk̍tpEf_@mJuzuHr#P|;"5f|8Hoȅ#haIH]RwC\>o_|zn!Bu1hwܢΜ4cU<I.0LIc(bƶȢ6k$I^ԪTid%Y5tohdnwmwi"!~ޫK%͍T_ch¼R2m8Z U&NDTUc`?ԚfDLu ^OI3,s]?$ -`k;K b֑SLm@ۏ]5[wO@yϤqX)#5k_a:kb`DlدnR/mۇړgI8_:)p- OJl? \?*ԖѴyZeUc?S ?F&75(tj{A9'抗591t6^`irfgtmV]u[:6Y @kCρRnSs<Il]:~pNj{Љ)i"mi9 2Xs^㨉穈k[SIyѠ5')) $r m`ia͇ZaTMr&L6<5%&sR ."H~?%e;n#?g2?lD_vL&s Gۤ@*0LuѺ M,tA:U7v>;+Sg\H\ӹ)44jLHisO={w\lpsMq-\ľE25 >-sFVn:wE rE5n vX:h sOU;\;l|_[==tq3C\ѴL |"Lj*thZ,|37S`ouyv4\ w ^'LCvljq0tIHps}QYM_b-QawDl$v $nn[@GY`=AȅN>z#`!/}6`P ZF.d$wNI/uPѱ&qsOfKC;C.ݲG>x:ץ` t k:rikx :o{ANBϠAl-T`95.qk)ɠ;?REK*E`֝ZUCYkC^L,#oޣ!no^ (nnH#S6;7d\#٧$ YM[Xa?@oޭӒZt+6v2<j}9T.qQk@"; !3n5:w)[ĂvLp.ka)B Z@0n%nF?'?k7HHrHS`h Nc%$_XkG/ykFJ m #mliw;[0q﯒BvMgh粋G*geMclM`~k1ȷwX[8ȏG\DiL0i|SC )cespy^ܖ X<:`Ha 2P}b5&OI۶|?KO1An!$TײmD5;﮶Ý5B̪`"H?Q|#>S$xѩ&;$X}e˖1pKUH,n{e6<Y9:$\d{ wh#@ܠdRSd\5lo-C3{6ѻz] ?EdKmmSq.h >-stw)6"|H9IHꮺl.losmWٶrwIpv6š,a>{0}|( wmwUgu6zaaomVKoN)V/O~?zl/{=Qe e1\~_6L 7hhn ؍{D#f o`A'QiQkfp.'5#MvNX[% DwQ6Z *SO1aZWGU8qi<<̟#3n<ƶ-om;Zv|=%Hqvټ WG8GUlz/nkk7y5Vc/wNe6SkA7,DvQf.{hS[5 Kr=wC}ܕQ~ʷ:9>aTVُ{ǗB{:#DzF抑UMhn# Ѷ+psVa/۽6VR˶˄o"=Ս>T 'Ch;H=G rJJNle5\B uٿw&'h'qoZ׆9kOhEp!o΃2KA O )UVXYuxU򲝐Hg O$mPG: {vDxyy'!?51.$)[?撑߻?>8̀5d?mLc> ѓF5`Mә'L}MںOmYIIݒiq#tkT~ر$B{ W2G} 1TK8xFڕr߂cw>I)5y_Ib6?}{\DOTr]oDDL8L\V[/Ds=G:6|#7A$5/ %ǴV1i4ոD4Qw鯐YY'ѱͯM-&t&4>"vkA>! h3PRk]?LCa~jUit6sz^y"htX;'9 vP^Bn+if !N,w?SNG(=5CٸLCnuf|8H)NèW){l }eyx0ǻI&nH0p;$ip>֞On[yqIGzz|*Zbm3Mo,Z]ߚtlcC$=w2֑f4uEpoZ%S49Hh( Q p:Q7oQe\ iBgCX^N#Q cG_ѲkkG{{\Ɖ%GoC&f Dw(51(H5eap`[9i #W5EMy58؎Qi<M2y>8A5-ٹӑ m[;nAv Vsk'WDuN6Fȡ,k5zҥl# CO_Q܏aH_tp P$G(~IF!8u3QCy75wTΊqJj006_m|Ls1d%(2lj !~ MqATUM 4$4ڻ>ƺ4ϸTǹ{ RH 3(  ^ƿhgA48:Cԋ:INv:睔 \8?BȶT?5qUVZA<~ {)ok%;8G2D XMlκl;{꒚ ` zIkG8N 4rݢ\{*5v<?mb}!EG7ݑi"  q!AM{$K"TIhr+-ش֛ aGqc8EeBUQ:{Ρc%3u u~W,Hi pclUSH6S'yHT:<c;`{$5EO3U2ZA.is2cvw f_mQ=}AxvI-.y>i(+TRN)o=0!K/PbU{ ZxSxPVwJF=C;voԮslDKOZF&U{)hEG) 'No&Ĵ)cC]oK";֊dsR`eXl1tr_Sy4$۷sAiҵinI> ict6..w)me@{~-9<5nhQ`'M 7s[xwZf߹R2jG`[71\t\{kZ] 3bdɕ>inx$4[vS,$URlGU^b8x":y,=BVH ?54cj?5[ ݆5'P<*TнO~hs ȔMN;,@Mr-.?lZWSu_VցJ#ek~F_wvZ}{cNh=N8<4!J;mw jDiEÎCRgW3Ql1eLR$L;5Q'^R' (T7h~U$ 'x9 u8D:D%1dvFtmuF4n;k^LFcb~E!h %!>F{x*{ӄPZ q";|Hyӄ$io<$3su";2=G~jhPw'{cPa3ZL#T@hJJchqO'T}CLr;1宖G$)qq`kQ7A8(nO}:FIq,9u۔|w0^6}`H &/[clXPzaj]ؔ:$X72`A U8[O r({$-Dg#"dRk#pAR۴:8qpv=(,$9$#楰=S+=<57`o3OS_C&%v0@IgqdKx n$=  :>!%:LJ@ԑX1ϵÅd9w*O!`[D4vمqh?uXŭWps9LG+!}0I5U]8y*u y=CaI)6V96 m:m'!˫T[U\FZCc%[=RݷY#PVmu;ڮ-VQs_I.7rHQ905T\$k\Z D#(`ƇV;V558ꏔ[;.q%i%T/m#cFoL\\vID)5ğ4; xALm+?rٽz$+o`vփ+aָV98:t$"`Jmiݠ .pWՆ{ ?MT>g7Q.'Gs٣Ӭ{yBw@ma;~XѦD})oM a9$Sb.k}FԌP`Б~<9.r|Snw>*Z4NtGM<W Lpҕ6 "#$KFEDǐN֚ y$ׇnXY@ ^f?t*hyByuQ1naq.}Ұ'n&7h1>+=[FԸU;> ?G v;n66#j,q;#KA7;A?FX#EKPqm&\ H2G8Z[qq¦ O# ;slӬQ3.$58) CoXX\LpƖ=vF5(lN[Dw=fq] qam%z@UJ":9M=q:)ʛUAt SHLʃ[G~tF2OJec\@v .JYJx׸pN54|<+[ߒTH䐬4h6o qЃ^.tZ5D~,k'?RSpsa?ZfuRsG'R?D|9Qxx AZEqg kmrY9:ӷ*tY]vL̝JGcĨh'IH }:Fu>*,)#WN% |:mY,8kD0 y[#w]N.ҙwVp?(?4$;xNB/s3yfڝ5G_ǤȹI1{I/_aW<ʽ!J?aC"1GLOsX9윇?J2*-`bb#XDzyZV~möIJp,U2SAj 6V_dօ[xըBWj7#q4PhpVEzʛ5Wn *ê%WQ,CZlӅ^R+`v8xWl&۸&kgMa qA7j0Y*Ĩ;1U fim$UTjTpQ N( B-D,)Eo(,0!JD#U JXSo YG NB> Ej ;\BJk90P*: 9u"Og ͓+AڅQ;ݥ[w\d,1iRTwSV#lQKwJku*g:K\=b`D1.mDaM%(%174)l !ũlLXp*{+zI"P.#xN4 ]ID%-k F-Q 0II V:"cY6buA +r+ .0Lt=_E M*PdIBR R(AH)t'NCH9$B" BoI(R(JBk`QJEGf@TKRj A>ԡ$2LS$II2J~QITnND(2t%& II4NBdI$R@IL JRI$IO{Pv҉aEeJr$&)&'L$R'I2p:JRI$L4$$I$I)I$IIJI$) F%I ʝ Z$RHP)eMnXb KQA$&I I&)(IJI$RSؘ%)$ҞTRO BJRIJR8M JRI$=L%):d!JE2.-ƷyBʻE }DccR UJd{ R)(I2I$I$LI$I$$I$I)I$II%)$P)Qv)d$D -jH N$IJRI$~U]H\zb_WS{ GuKb{3I.> v6|JQQq$݁I<:@~x41sXdX 45!A;n/FZ5Л2>puL]ȏ4Rdj$!5;)РcXcY,;_+VU++ckuKH'n;-R}[I٤> JB{@!w8huRq^ip{%zrdl{>7LwSp-LBKᮏ/(ܒ6NȂtDIiH {^wƟ~UXeQw7[w9tO cpdohIH*н!LkI kY&!OUSS\e\^^Ruq)# pѧǔB, ? 5߼y'Kb U˪u X-sp}γU IsCez~TtA 1:`L<~rO.38I(lh/z+v׃iY;ƺ]C "!*2M56|tZy<;8%+Xh#%cG`w !Yݵ}O՚l 0tʅS[Rݮ'VU,Z[sϥGrc\'\ c`IMf3Z~۽Ӱ~薻w7rx0jd(۴@(Ȟ;1'SNGILk E4>]QakkS1]Ƨע[Ҫk> hiLṧO$:7A'3k455Zq0*y.i ?G^k:ON(լ݇W֐]Kv= mcZ$sg C)%FeVCv]md5S^c'n|nN[T;"`x`9!'p0ptY־o-%iУ2XsLvpU/i2~@8 Q`xㄭ8h4㹎f:l<8GR)v'Ss{3q䋝:'lA!1|(._F{T;o{\vDnUz}[{{9mPSDHHH? =UszOvIL͵3ݮ~}k {;7K.:9It$8U $$+`8@:x !2G0?wR;r5s[(pR״6DqQ1}Dg|;/m"b}#r5$Dx&txx9 OAH04e:Z5[Tpyvpn-,8pG܄Z 4J"X!1 %(ǽ~ B#;?-/k |_ױ ='a{FCrn$)ճ>=;8Ob\1xs16?~/I$H~>_!=}Mc;'e2KޕyB[aN/&0˄f;{[ז)dW`nxxZul}ΠXY m?e Kv(SoOvSst/)9 e&ȏȂ>#fK>O sYp D7v\ƞA%9,ysܑ+92#F^,Y Ti(\ђlpS{K2!&HB;=S ɸ~mN76Gwjݶo퍿" kldY OvGx.n9<..22{u%COwJ`vmX,k}u:m{ͮf@0^ѸlѨN8>k^d{IHKjy^w +@VNV[ݸA{z5cPqp҈}ħ{Z k,0g%';24P9ָm#}F/ngUwXčBv>?Hx&F'$Egv}'kG#w&;\l{4 Qa#r~HA~|-sxB)hPqP-d>&iiqPjnE,ۧC} 42{y(3~%4kƶָ?Xt1\>׸wv'k'T\uGyLѷG6}V9VHk6ɶt1Pqp|G6ݫcegg4;ςM`$մAn8$Hf`[g 疽P÷!kO%AgdV22Q24m!F]Xq?c,at7= &yo!)q*Elw[A2[ɰ hd<0E]BgUKat"4Z< {ǟb$88 5Bm%%5shʱ0Zt,1rf6K"r:wH?AOGT2 EK[g~JV6fdi$S"]c ǩ}VQPzu"=$%°ݻHw˼0_a x\-R÷s%p5 9H&ՉY1^gReTRəqF L;6'@CAMlY ;6kCZl:=\6րG([W`c|ai9Ks#St8XIs9 C-D T牃w9;kq!3_T8])>Te`٧4Z݄y'M4 G= * Xw'5im^Zw;Frdݧ:{#NbRU~FkZ,>rȸ\i 7!fPD[IՎtK{ꙕ˄Aqrq֝KI =X [)ed'bQe=6z5T9[v%N{'چݦ| Z&AYc2+`sG#h6YCXߠtw"\#5'X80pOF1lQLt= xSku0GM|=zsI#@eZʃ$s H8}BM *S}s4~g9IvHLrw0c솃jkX $+5 ,! j^9ɦs"[o4[~AZ Mm:~}9B54\ٽYyIIXXS 䩌޻dCS8yR,{ĝӶcrMhdlG5FM,w)9A;Zs%!ϱ+b:4X-p& yBUenl88kKmf[??5Eΐ?4r􆤁: |Rh6=1JN({_VkyG/T=G{K%+Lv4n[(;AyvPө_Y~_0y4#]uXM?yfUkw5;?S-ub zix2@6CI0[>% ?ǽ֐5ʽ <Am4:KZ;QUv0T5ܓk?9& pTHEx~qI miRCgOhAHKu)nx[?y;q1H}oiopUQZ uT¿*O ဍzBC)6oENEɱCuhTrqC͐ 𥅝eSLrNX}#Jb;a!*:C{xa%~O}%t%(Z+ _`:1tM- ڜ.n4O *6JCL4A٤<9p Fs;QS[.s,Pv/Zk -{ˉvPm7<iN?{@;m>h sl0p;kOy:&i{nsm&f4RskW{қkcݸ ADu\ (pi $5ɾ/yU=A 'ARl[xB}[HGuDn)4@{jCp ?0XmB=Aw0`=ڤvB~P9y2LrM6Ik[5Wv+een}qAp ˇ/jvé[@qy! kS_d]OU.>P][a-fg <w]=!IaǸuM§~éo-,jrXue⬛)c@sa?UIBWct-!䅭G XƳXijUZinsɃY$z2CYf[?/i c||eElZ8 [KAɺhi~Z-{c۸@O]]2,:9܇(}贴OE8s\/50cjxy:SevG T% UU!޷yQy B'h:}h=!4:)nk0oupXr*k^t&}noݿ]X_q;)z`(y<@tk~)c~20jyc!hrU d 6A|2uegW!eۇ LyVb Wc h2}?6optYi;[u"w''3nPG!ƪCu;xC *`F.\DDL9.T9ѢPcEΟ4;McJ[VISmNt'C*_xxpTM{G O #eAv#{(8N= %.NVַ\xR Gd'$]D%D1#Dkyx缾F/weOuu|vDvU \7iul l,;!0:TaPցq>#Rp:x)5p$ꊔz@%<鹓K.#eL?qI2X8׺nAJvTA%$sI`k\> eRqy_Ea8?G2!: (O;tHXHmڻJli$6;]㋚KY>pѕnw#,c hT^K& &G| ] $1F:ײ;}'l{B n (.oaQhQs Ѿj #|°I 6UTͭ};cuO ϊ!,_YiC@0N}B^:|Qx|g_rTX& آN?z|lӯV *">2.EF/x)porwx$=$ZÙare"Cumh4vQc@Vh"HQ.4<nW/p\akN<;UmM;waPc\gאp8B4TV ׆l od'Cj{Ύ<[qNXcyS 4 R"~FNJ NB @n5sKW8goy >|Rx$F5Q#'ZJVqN;*ٍlg&CIR;V)H4 6֍*M0yw(x%jmomO!;3Zke08#6Vaԇ_r?h5p:PYXn'O ͆A(kO,mH )uenCYٔXuT]H>nFŲ7Վ1=Nƛ!<=M{ֶc*g쇖~'sqhk6Wcδ~t{e<:m&\tHC ƉŮ*-A%4Ym-l;Kj]CZǨ TKXmwF}"}'52K7,}-a4L1xj1eۡE/6;]U۱(½GF~ &I*vʑRSGF3zCF8eC5ԾT6>_Yjjfc:@}~<W&ϯr|U?&OJ591zMV q6X"F{͝/ǓS༂fV\ĝW}\gqSGไI1{I/_aW+g^J0Dat3ҘUXY\Pl?vDUamp(ACڡ$-N֒%PpbHxAAh+{!FsC3.:`1q uQB$ R^q90@p60 +_oh%"$+Lj9M `'8&en0-D9uv˜ -EԼ5*d +XD"\` 6H0[CHdB f)$z&UgӴHA HSyRU2=AHAxhY4Ni ZQ+Ut QUʴH J0PH A,=QLL ١GsaFGpbBF{Z2DG6Dds+> 6;X2{)G,*w$TՌi26 Mt2)=DnIm0cQB hH8H2Be I.l(Isz Ath @(JJ)QqQ.(T,l -D`jz,WȰ5O.UO)%B` QaMMDB+(^Z5Y]H{Jj)n[-A3Gye[ď/vAge>Ǘ$<&HDcq?zyq>!5"k Ծ9VyQW[t;^;~l'C7j $4 ()2uFar-`i<{2dž|q&#TOv>䅢kƾ(ҘƷtgQOUM3dվ(]rٝKp yM#4 NC wHA-HN}cma>RfKK`-lp9gqi8֙ qAjt4g&1ȀxvqT˫i,,sm \ƾb}@>NF;H{w úmoB;=K_X xckARv8ıiiQ iQS!45ZyM\&6 yn͇]D%&0?O3k ZWYuMsvn7$  x cGaIU|˽"EaGu[{`oի!ȅ% ,csxKӆ򄏩 >U:-PaB/}vK"4Nⶒ0[YjX fhg ց,{L{^6PCwsFƲ am嬏k#}A*qiӯqdSuZSd;BkA.| Q; ui% ָm"ǷD5[-Mk*SIc$~b8`XB7_|*aFS͑艎%7Alz Io 4ufgR{{ )d4{v(uG?*L{ Hc^[-%jEL xx}= R?F)sD}Rl'[ újZ %1=J`:KP .6*a[8YX65۬]DFN9h4QH&][^O'R;-8hU3ks& ~)e>`o_JcAkK.yr;{~*Msou&Lo>QSbKr H.a+c@O,Z~Uqc]dhџd >L9;m.)s(Yदy ne~Y3Pw Zl* >'X M/x]Wn`N\s @T F7PSDÜdLpQe7K'>, q3 nC`I'ICX`><)5ILC(&@#6KZI?=ҁc}[֍3݄L:w$w,FsYǒ*dl5-mYs{E`.hJgx-=5tmm!H wԀ\7ۨ}5ֆ;?[m`t+X A~􍄒uɯ4dwS?G˺ZO^5l4A륻kzX74k [gh8 x`S>1#Ûa|]1)e1>k;D%[A_\Y,-' ^715 Sɤ!N%S[Tu*-ʹXu}Rٮ>:qX_w B !V(aV댇X"[dUһ1Xzp-fxVm yt$* E9D Si/&<|&?uJ~w5ÉZӳ, 螽pRqַx^*9eHyV7v@IN;7 [N!>- wiftvR>5o4Y5sjNJ`9OySH$#1VQMEm:4)~ x8k&͹!xori#B%0eq7_"3܂[3' ]fge!ZY 0<w? *mNKIG'w@OŻŏyxڡmtiexw PpQYˀ@{XKn O>R jZnlVKcP~k-dгV7#XΟ[X }:n̢1%cHk|xI +pq롙9#SxIHo"ƛ+pqC5ۗ0}?HVrjuL/igwf!,jԍx| ln$Ilvo.k@Jٌ=3w9VH.΅\~Umh kl?5Wk+;?,F|6>>КKan#m͉SH⹒C?xkp-АĞꩴ wPev GXEo5i$`k_Pnl앸c3$i'k ,~ݤGu>3q'MrNmד‘iify;iRkY/o{BmH6m5ihܪT^{Y:C!;3!߼aqb+IWN]~tCDՠnqqne sjk̔q`;ivp#5GxRF9xmuw > Mah;M#*d[ 3n5^uw tT{ssm{&=)uEn8҉Qʓ A@h=7ߺZHUeV9-Z&-ֹ廀Ubj.v~Z4)>H# 0 0P}#3̨6џwIHuZǂHธrY-cw=~?f;07ak{ŹvdR*1n1SMQ}67<ۺH.>!$1nw[K\Nktv[Rn]4má*2X'])?BGs*FsMcvN\Ͱ8 %ۈ`8il#U䲀;xډ],-ppP̏Pz{uE*x#gu=ƿ ϴ8Ps+S]mcy <mM$:N[~`49ڐ µUW5ŕ,:Em;}M ߚDTߣ47QHo+ V}?K\Mj '?)HLN󫈁esLOvS!>*Y`QS\2S}tYSMu,˝mUrx~K7Qsey7Tx \2uKcЎQk B" `.Rw oV˛=Wq/ QkwVL%EӲ!ʋ {i t䒙2]~]}c\Nf#21ɩKKvMC}1kap?9IͶy9!v8IktILu 5ÞFe'mc⾂2j 5-{CJ>i-o'OPf etCȩԲWu ?e ѮcxmtsGFp]cDާH`y y33䒚x[}wNCC4Ll|K=:6 ~*ldEuihN׳ˉ>IdŃi&Րz}"Z;Fp: {G))vo5\mY~6h1ea3%W42A(}V\"\Iʅo iLKgWq<JOC~ H~569+<++yugyliOea%)$FR.1T]Dg.~2ЗE2[7J>X}R-|sju8w:粜P m1~ш\L#d2ḓS qck3uodjO[zXƀrV2r {Id2դ8)quHGnh|{ xipum%)W.x0 qOi.tg.M ޜ|}Ix rg6zsDTl>+-sw4?N?Po_Qq|#!@suBW<{A}7{{)| k7dHR 5p!t-<}bϣbwVAAo's`.46,gl DzNӮߍiΒbZI-QÂz*ihxJZ[1Gp- @IPN4{Za䊚c6Oҝ5Bޝg=hg#q1cZmXNfǵAp:^ Go4H$i{\{ ̹H!UN8 {-$'W5#MHe[L;w*M7C]`y) ǔ@JwE)NX 9Ө*1ݶZt'3k (YY6 *d3!C~ }=6)-aN ųĴ )w&'vʕTG˲,;}(SnkY[G{Dh븍@{=m>u$C@"IcCx.Ʀ^_NMh0IXR|̓hF# ;vאv Os@t?9b u*?mܻrh'FӡT,LOustoAIC[$萫[罾}:9z>3V~i}K9}kvOK 2;)\  @⊘`{Z-=9?>+m$iF卥ۚ7X7ȦVLCNe0>)F>>n❌^V=m谍P'a?HJ9KF79$$%3iw$Ƒ>i jGOM+uV *,D ZO QqAfm 098O5f̨5x^M0dhϙ'?~@-.; ڝGgcn=A>C(-ӲfktLG@%6[k/3w畝e7K3E=K̞=F@#׽[sdOmp nxwPL]&t6IQ*_6Q!@8$_phc~k;8- "4Dub7;BktrKa]T ҫ.v8TH\g[l{S_kKkݿHYY[v2Ȉ˵q^ LWSh~e%eT9e ƑΒ{^>/ǩAM5 $dH2m5Qk\ %5h3S>mw,ţc;axY&dl$, s&eDD}~ *b3BH"h|ԃ'TcQRk7N!CC6m05MCFE@=Cʑxh>⣴́<ky(#iOs j|wn)ou&RpK\ ;Klpw <134y!j\q7Ve$8\@iʰ$&=R#ASX;  ); w`&p#:'s{'DZF:Hb!>)jt'5uđƧϲqOqݐl!K9UX"uc䩁I ƚ{1Cu縂h2\j:"eg:*nkFTY$O'# ⓃX=jV'Q䊒d~{MmprUkwHoZzm!i(95F"sv#vl:O21&p.mII/i)[=6/wuInQs [v?i'ݯOY#)`ϊJQgGL)A`VٛYׯ 4O^[*p#g2w'S;$k%В[ebx#C{ӯhw4g&wv)0X!A*AM kGGu0~5Xm~ir1{各YtHcSmPY!L4#R)75v!7VƐewОkC*fM]K+ <1GљNsvFР*ul) l90/aIJƷa%F\'!xu`jN_Y5`{I 9OA]GAEϸYYh^`v]e@mlFH]In-a#C}߲҃ݺC5rG(nh6 )Eb]zliTY4"|JF2#AK@n8 MxlvN֟n&B*d]g^]q0PnhٻMݓ[]2n;Y3<(m%>⑬FUd075Θ)M~Pa;Nʖ[ݮƐ?눝:H:'E.13 >?=#L mq t vŅ3hAD'e< &~omH2:k&`遷bڼ9LDBEa;kx8shD~VC61봝GT={n:f44^j 0 G87۫u2QukȓY*-%ޣ^5Jh;H'Q$Ӓ茶 z!O%__?3ʬo'a󘿽?&vGTk\sgF٩xhq~; pڽ'dMI$)$_aW;83FqJ?aC"0GLOL眶.p3ײxN%D& *ܡkZHE! mV[u6kD"th*Cy6xԯ:A/c\yX],NJz}a઴'(%Sa<(\r@hFs ԡ\&us@DfwTD+P=b[l#HcqW$*٪& I2RH*ìߢkJzWꊚW6*Tz[!T~NJdQjhNaF[F۵@'EYTab y*Vj|eض GT%'R _ A#m2;wgZc7iYhpGqVmЙH)1ޟD&2=OR{`aDi'gtj-AY&As`2O|& 1`W]"HcqDkLZ XZqY)Gbkk=CFT]iOžt>I֤f@%a|֑y!;,ͺwE8*mn5{HlU x8Hk9ٸx‘\gly.U76V ;='i>=2t^@x/hgxI![hS54D),c~ X?s;_?͟nD!p5Ogʍsyx-tA {5 qirkVYh&J?u=ޛ eJoI{igXx?Q;=kR5ڴLjJ9hG`~mAMa]{swdXy4 <(e[X~үkc'Ìc@$'/{෸nm# C lh)yk)$Y>I3wv=;(K>v;ADO*$nlwd[]C^)ݓnnђ&4Fne`#k+?>EրalO?{ӭ`,$έ*.} f ]IM6VXAXQn,r5i;ӹoNbݦ]I?me-c0b=c}:lgbjzGzχ~M}÷2ӿs`$;3 k58}OJ@˗*?ꑪlƟ̝ۏcSIQ{\?0XzNPsABoEûx#H)e.7n#YulsH6}F+~|R9T_[rbT{x=5C !Q$dq ;dj*6b[Tu$h=9p ?G"@|TaC'->l#a6f:+98bZу;AZ'w FNg_okm >H=Jd8iH؏݄mMqB4{,Հ4WXk5pwV5[kDXS"<8ptkE^tx| h?5v<तtL?ޫ ]&P8ZQ԰oNƲY\I@]8KG@ '|RRzAIIr#IS{u~dݎEo3\CZ'OSzwãDG?O0o$5J3+ ZIHWUlwѳONe]5.kM*9v\wuݰͭ<$;k #ȡA?"4I .yf[Vûq-{պ;ekkٞ>dN`w& J3榃G*ݏ ,,0~tS8mt~׹vL=@#uHS\7}&S;E[?w(y8@8<-nl {(ɡFcتWܶn-.wര-ԱnVAq'?HݩP7WA'߲ͮ*k"A &}UJjh41zL5z$(:HQ0;W#mhZ\ub  w]G݁[f C[N<|kX5g[kE[#D 8ͷ%՛ K.sI.hZ J6@2gjnpM.@ت7ii0V/G 2[o)0 UCn'R-|nCm GnKçURܧ9D@cPWƴv4)B,k0!DZ@JO%1yPJRZД'IXBQ RVД'IDI"RR)VVڣ鉕4BwB} b&5#P RDʱGP-b  ,k̔ {mr%uXYn7xrl؈N >yA۝|Sp-) c$Ļ|F}e״ݨ8H,hm>$X 2t$KD݀s#1IL1pL$vn+C٣.mpCq\+p>v84Ϛ,B>>;]tMg@ѳe>17;v1w ZX$:9 we0\|Ge͍*MiK)SKX4GgU΁O#2\mhkvnܡf;*k6y<^}Vø"CLA'Aa ?j`Ĵ7=X=AچofƇ8B6msYd|Q6&`%1Sg Ys//$bYtU=&fgrLsqt>)KDzL&A)j@>Siمʹ5@ xt l:lJli] vz\mW~I's9۲\{-~hOJ8Yn)ҮLzl5A!W!}Uav;}u%BMky6elcFOdOf8 M:eI`12{}$?p&5w))i`fK{o5 +5 }?&dd_1oD֗K\4s>qu %[?xm)mS]2t'fkZ=(_>"TH`{@ Epiw"׸I`8/9)ٻp?Ԝ瓹 nf5n fCG߫m~YZ*=JI'ÔwNKi]m|SZҐis3XQRɰvƲ?Amԟ1,5}dst~aH5 wM]ܦÚAtGQ-e肖_`կv7槿 <~&iߥ6ݑ GNѯqwO? 1^Ô!l|S,#) Fϥ?/i=-0Y6KZFqw7_%ײ%e@<7h *$'#J`< )oXITKZ`skG`Y4z#[N|*75!ʬcniٯo ],oI)fiM~V-:VڴyoCsO6s۬hq2dlki AMګ`[>kT1Af5c#Q%mD˹R_ct}NK+κlZ~&{TmGuT y3p8$99kiX8K?#/ڵ?]T.aqcl:{(vIHq3^4nO"^hwb'ib-tjʪisw u=;7i{8p&3{'&>TƮ}uODl:+9ղ:*xOf>%vkw f9l}0=OwCyD=#$ |9AH=Y'9U[YU6?@%ұN#-=p]?'m-$$^6$l4z0TG07} EkdqOYK^@ kI״멾Gdv@7?GOOq6j/e.{Z1MB?H(5dՈ4m9xiCOu~Ν{nIhv !k\qcY:᬴i^[ h)nbK5J쌆\Nݮ#c|HU[` kG*vT nEmGӬIh?@D9nԷe6ݢ ?-@aԵkwnN"44^CIA\fx슘QF@ikIIdP7/KZZd9CfYm)nFEq4FxԀL:!]@{3Jh8;}Fqa&H}؇N{^DwgE@US6I~q8pul JP\p4Shdms]t0!Yv. , 2e&]uD:wpZ+kkHs>t?moR54Q Jjݰ28~&6 1EƸ.=?[c<"ep::G*.K[ T 'kT\f7ۺ)gLcCo'Bw81Dp,:=7u&}\ګ/pvI~k &3R<6tILFq{}e?C kd->Z}{dB56˞gc ݹIufF'5|G)~)U:9?>F{ZWuU\% !FmK&=KT}B)2GPHosɶӷ]y'5cy2^X*MsfIe#d}eqi'X5wfgLn$4HΟJG}{ݶ07K?;XKIWӪ猪騖`Gܙ4xRnGRۯ\4ÈWsxka}E]xC7{}?5adžZ[HfM߂1gMHxӄTT??HvVa}nl~z6`p$㚇SACH?KZ % $\ZuI))A|b:+UT톰rW*0a%ߣɋ' I?K0%}Ӈ=ߩEF k>)./"SeHXS9Zh06ŵ_2VA!<|P> >X$1\L8ݟ#u'@WUK[[fw(cdZ'΄pH|;'{CvSI<g}ޮQ^=s,.cx6]?`wW8h ۠M]ԜnĴ>Iߦu>);""h8~YҺkFqM#W\'~GEq`>Pf=NQ1ߙGٵI[u<;9K,!0οLUYR2ݵ8hң]dĐu:(~> [ꖑJr256P)=pa##m{H"@o姥}X`{Gw%*Pm'hJAFA2?;eoiq8b7 _*wP($D5dvSISJʃH|m h~ O9kH{yDÅ72BRUY`hPAF>) BhDGtɍ y'$oEv';t 'U=Y&S1 \\tFe}cRۧJ#u1. YD[w8LvCvHG KH :Ƽ$&~)H1"44?GRkcQ-Y(`%I'ۚi´Cl{-lI⁋ *bI=m3:%]qljtKR'h 8&v[';(y5~(day*. iAKP4pfbIuΗk{ <‘& 3{$mcZByp>{vDKG5ct`x;[d@ѿC8.MJ4˴1?5NF`\miH <2Dl5glsV d7;uSi;%7n -,:9%SX:N*=U\lUkZ|:BRv$ χ"|~2|9EI]2괎]Mj8ZMc'o&kDD_$j $~~k dwYm$6{MipR "wGoOpAJp?S:7eX)QdpӇ(]m晻Ki%0suXn1U\w JVz.oCg#m= O\׍ލD?H&}5?vyf;y $c[YɲN o]⏕CkičxqGRmHI#QRSbIkU-q;s\1·CPv |FSGi'Rf<-IMw]wlk4FmeLEq3mosR&#El撙1-;?R"5}}7[ Lũ\֍@jw}7pCXm"%Dn;B`>JvCUU.eܓ>RgIÔ V_dY$AOt:G-l  G⒑w;VY9WQ7TuY۶4!iv:ZE`9o6]楴&N$6C@54O kڣ4d\ ˥co/NL1)7]]X'%"ɺ%hGZEOh4~whB9 jt:.-T m{Ȭ)S};nhj7 N<N:-P;G{ALy2` y$nѹi_j[{_-$ 2YqxU? *fLjoխoJ-WefcS{~l]G'!p1s>|{~*LƣA PN=D>P,uC GreNaDk({@R8sdNRRIq{1A XMi#?U`[ skz~,7"{<3ԃ0| ` #zIkA^9gDe5̑iSv6-ikԸ P?Gu&'ۢLc{߹" Tf Ke2ɾM}gli;"*omO59giK.C[&AAqp;GruA>A'n l8k}&69Rb9ͱjasD߄mQr_*9]Ղx'.)?4S2֋Wa:U݃*5ݢj,E }5 tjc ̆T(-!w>oq I Te8@Czl/qK$m ߛSU^X6T3h 5jZH|xAH*'҂Zu;D-ILb\k!Xci ~Vn SƼ$JOhqSHn{qaiKߡ-owjjhʔCCGޟ`2G!DwvZ JbΗ~C_kGSáYȂ_R#s,s n}8~U腍:w^uS;ʬ2vQ9l]sg'W\٘۹?rswZ_vs9m.gwldU$)l xIAr'F6^iedsaU:Δ#Y]A!ocZxjzJdNB¿fi]K;%y=#MuYMQ!Je"|+QA0s*V4MSgTc *C'U+ `D(X6v.i\ozma*"8VUlAi : 5!&QUV: BE ƪۢD@&ٍ:_IڧDpj*,8F=V}U:WQwF.gEtb2f `Ԇ4ą2$)Zd*.Ы2YҋA Tca[i\`B,&U:T `,w XR~n8Y.V.A0BǚO%׍Z7vU2KJp"[}gu 9,ҶT\nH2t)7@TeLRS6BJILSBKK=p)ZaShC:-5AG9Ы=Crl0I P ( jڎB­յ`7?X-:;e%*XH35J1^eT] i?6T5AL idp{o]w0 ҳwi7Gu`Stws@w*biunkZOt?E҉e8>A%oQfX{}+}~#'WK5KwReT7A>!F4Sm-V=Jn7[VYWmw ~ŸOc{[Nң`Z(:[ !ƀ8'~"⽻śyc#UԜI;NwхQ!uOHM]}@6Kwȗ#QqK{}vme ' 1KzTS\Z\HckV}b։Iɖ8Stcv@1vw ]-^9qCʦ%Kn~iD"ڞOjZu rC)=y GkcaY)$a6=75:ۑSn)k͝L*WU[ jkskq[s 6kдtaSZ!X C9T}*?v䥈^K뱬j+om\|1 Xk\]pX?x{Z4>AdȞKg INcLsPL׳q=VgTsc3?ycI&UI;`dl;Rk372îh[ă +noy0w <=g]{!6ֹtyBg< p9%5suYji`w.-Xy{&MKqڞlkQcX`x|nrVV={a9Q!SUչ60@vM`0ҪyXt%E$rcw}S61tyvQ}:RRQԷkD&--%_sm/qsmVЧ{aDzV4E8SOo@վSjq`oeKVqZ}"e=UfAh܋'QaYtpl~bf=Ц^$v=kkݻTi8{f?hi-p֮6QI־G6΃owUȬWK~:q~x  }MދvvC&԰~Y@+湮E{[pwjcC\ N)ʦ=ؙE~AN{]Sؐ]focdZ~Ue{KhJ;uChd8D oyFn0p߂suFﴗUK !XdkzlΛ~o`[UKhEf@VNx{ ;OT4:=BiG;܍N%׹?I¹Dw7g-?V8忊=ԝ[w4f_lԃ $׊uh,?@Gi_m+Z׷A+jl26fG}Y7u7X5:R|>Lk}Fȕ}Yj]0@= Z` 7QS7~YοʐAaOEGquz@D+a@+qP,y:?-2B1 ›j%=&.%0)Fk@JN:NHY$%)02[ʊtTI)'%FRmJL$*J$I8*IJRҐ))I$rRI$$FI)NBb U$EmwVisO08W ,@*د8wq\=Z$0`MgMܴ5n0< 71j]lD  t5IL=FZ=/{N<ai|}콅fr@5G:~^ƙ2;'4WSxk\?R>,sxvG!FeQZbkq@<;B|{9Onx$m8q`Ѭh!]lnLzgoN4NlkLQ{ i=go4IxO*jnn [kǩQళt Zv @~q\#+ik^O1M̪ mh'IӝFHF~s3#_=Vm/,# nd۲+EH,zWo?p )-%59K$?,bCN975kgl}ᶪkpn ۶vE4tDpO0&~9̨yQuxYi?\XEmeipd2uE!<wN7s 9br kI-{Ń즯Pr sjcE5#[ӫw GusAsyB8 k}8$>q6]ϧa\]odTZ粒Z[F*83oz\aʳC#R*ƾ}v;Z&DJuv=L0>`M}4N@L4E,܋.;U\¶Yicts̏2$wdRLG#?wR`y3X=R ]iF1ݭ,<}lYu4Z`kx}e-ې1c\aL@~vCk^nŤs;)K1[YEOpwvKU)^]^Dhs$˞eP{Bzw8E.))cC\nwI'RaRiK?Qͨkhjj*m.9M}~Eo<wd˴8"Om{3 )}7~+N>ѷmG~*V2ÃDP,8`iD̸'7;t-dr1Ï# Mt3dմZ7vZ'qmmq`.fsT'fe7`?P`,i'Q:?^Arلv$@ N*Mïcˠ7S^;71 [6lai;7-VI'Oc<>uF`sL;B%CEN_OfSֈ 5v9hkv|웩9jIXXD ? )A]0 Nk(l9V cIHcH YQwp3HCu6x?EuoX#YGT;)ͰkNh-Nكx^ DxKk|B GY}@2MZa;;;TZp>Y>>oK5I;wh?Gͬ '_EzDTLs=?G*9}KKШّ!ͬN*XxN Xum-[qmu5hA.c{h=ZL}olYW!H]Pp9gzzTV, ^9 q=P֗IoGGzox;A?5Lr#hY;>7wԿ%%mhgJ <\NPpېXa&6VG 6I"k= aqD/(Z.X>ꨛ,`?*cfyxc2[ OLx$wO;s@$\nk>()6]̱5kJV -`4@?H j4%`ǡb .$thfN0]6k?QG`Z &&4IHc+n(nBk#ŎswRkkEyjƇlW0?jlu#8M!!ORU$JAv++LJmcno`>ܶHVـëN~;Jg oo)bȝOPcl:{՝};u1w()r߈@=C"H2?9%h9D=Z+ȷm賺Zֶ9R ~Ee) D־ls^}/% a <#eYVC{S乎pfP`%Ub xٚK CxpQzd'r|.J&іiY!ЈCn2}yQȴn3q Йq#@{$ֹ59AFvaӮҍpJS-0?H5EH5`O{HI)h$Ɵz*B% {߬!2pyX966d P/5̳~j/AĔ#1ִ{`y(z, 9,9@>{jasg_ثm1&uO"{/$k"=G̒8D{ '^1j#,{΀5h+/va߹\{B3llJTuhl:'j%)o&b;)49AQueHZtG'Us6Wj(6w; iF]y9ψoidsR|ufƐ#e`KXwHRRv5άOdGU0)`mȃ%﬽cLےPipsTl D7@ӴƿcV^ʃ0IongTn;cE[eHmLiha<u9iDk G"m=0a|*ONko.JMƆ_RE,7>v '(׍`^ƗI S0dv*VH0bez;l~jֱΦʆB{~huNzdr-mM#=( p$y': vz}Q&͢m g_Eʩgr.3m9s}y u5k=fƯvƒ {tvJC=IӸEM77!贚#(;B;XbV M\q;XD9wNDx`Ӵ8h2Rwg]wp/zKtgmG%ot'*Y}0g_R{\ w yh?Ipǂl=R wSY5d@rFCa;,-_Dawd}/7Zz?!;FNT#A [C`ukF"9ek)hm.C7 ZMgV׼ H&\=qs2ZEc*LbI8z:FA+eMͻ]Bjs_i" R3nitǻk]0$B^n(s5:`Pe۸:CÊgT,ݺաmPDj?8&։ U=E 07N'a$؄Ѳ aBŲ {/zi!8>9pÚ?Q>D5Wj{BFRu;`VFy?H[a V {68#x\ΖXtj7K]4H)SQBUڪ":KUg[cFHg~crya?9DTL|ĉC=ہ)M6Ќ3U]~>QOc!uq,Ƭ`?H42Fl J>",2ޔvAKvᵣl[p&fN|AmuH=2 0c{B~~7ݑELrTݘP9\#Cc1qkk88c(նKƥR-qѮ _8c}H$ǂ0!mհ[[Bqٔ q;Fļcd8Z{a<iJTLa'1N1%$nT#sFk{?QUNўsGcLtsG=菚kt;;QURSN]*lάXG<։X7?5{UT.!j HthG*-:I>> t8mgR#vcl88{[M y>)`"{(}Rsp~v ٧H`xn_^؄͑OT @ڑF5%.DV $fcZᶓH~jz8uDkϊ;x7hM[ Jia;gX$Э:b x,owiN.nô|R;He% J|vG~H"9ĊG}P;۷̨C!Gt̂Jr3:$#IImik}&@:@69i?sK "I̸@! 2DcATT9`eMكg-,LRpI CEP0ǖf=O< m4Ճ!Q:x$ZhI#&6X\FCh5U[jNkA8OC.'CGi4M!5L=Ch:ih2];Q>Ckxl~\{LJV{[y$ 7 0 p6sئ sO*Nc١_AsC?͑ONiߩ͐NE%NX`OyP-%| Z7vؔY"*[4nE*i(lk>)l.jV7mkq;/eKZ8bL p??rBd|S8{~Q^ߣ*@^(6ٴcOnFnPwo_}>' P?:_4 'Q-`h)Z\ h" K)vw%DL XO xBMiB){{j{^ )Knkm]QKG}PwJ}  t#8 쒔nu@<=lXAf49OgE~<&uss.P 1dǚJMV^m^N> #9΀ݕ~Vi ЧZ{FJdzf~#["NESfw3n{gpvEMfX2@lz1ʩu\X߿ұ9c}JE]SǤFq#B;!shP!6)V S@pc:?eu2ޣ!ڣ5w5 ! S"F =F j\):UBP!R@|WȐ}y[HUy?(?6|u^jOLϤȼq!F⽋Kz^(vT0I&/tI%_aW2/1yz#Ck?Jb}UrgʱÂG]Zh6]6J&(*MqZ}6 c[ߖJl-7u2C"jTYAz*UYEa )D)%JʒUcKr&Nz&:xZ8LY$I'LJRI$'L)2tu)I$tIK$I'LII %,I()I'I$IK$$^%,&NBd((J'҄I$I$%)$I$$I$I%)$I I)I$d$I$dRNdRI$I$I$I%)$I$IJI$&N%)$I$$$I$JRI$I$I$LSI'Dj@(,ID* o !pA$I2JRI$$Ҕ$2tI%)$I2tRI$ɓI$I2tTI2I $I$$PI:I$I&I$JI$I$)$I:dRI$?DOi\4dxl.G֡ .q^1ڻyo☂:i*4Q9 }N'-0ZAST&[aٱ /Ő*k۩iTq/ݕzu͵L6z_3*K-%aiv4%"ޓAi]' 6I'Fm&Njt%[_U,>*5"b;A'X9JInhaٸ8LNm(kwl 49? ƻd>=}D?N8/hú i׎-{8ti=9i8{AYCc_s]S'GXn'g1aBg3hWݷaB%5+v~SjZZ iaVQaeuJz=;R Ǹ[cC)kѓL4j%ArYFq 5bWw;7G$]Vei(α '}?< 2})h! Rʺ[hu^| k9Y ̘y~_G ii[I3|I$vYj4ܪ?lN(Xmlf~=zCZ6k=tX};#RyZM x| -,=W4q7nI| nN;ve\gs@yԁV[9;kdug-Ty:yP%J ˕jh.W#f`OxW۸ )+x!C|TR{K4P Bt'IGTND$Q>()$O)EIHRQ)()$N rIJI$M䜨I$yH蘄)$O2 ptL2t҄(RI$&AK'L8JRI%,I'JRJRI% RI%>rIJI$TSL%JRI$B))mP%z>($H, FIj7:je!]ξK4XROj`L0iBP؝<z ZQq BD[l Vҷ2!0O[eHW3VY+ق9F`$mhqc^;3\fC+ vGeaxe+dӐ1]o!vhub5g-?zNH&:Uf;1wVFWOsu&}sktA_$vJ$i5.K ]s׫b7Ӵ t* NG3IkX ?IPvk*ξӴm^&c _elGķzF{v{N+dZcᴴV[m2ekF__ 5xFƖ|M츟)Eϴȯ}ސ(:M/!Yߠ{ziqBae?U:)9=28͸lwOåߥ~ ?ŗs8F?I؁UG#u8:wjny7xohGNp?E`kfv*,<AHlm[[g3Tjs[g"_S(#D9blq!1x%J5A}A6М2ZeEIE/k`}Dj¬ee.nai}ty*.P^Xݴ+YaT+cCbGyLGdom=uK"?tuh牳y77diR[v@CxSAP\onpƄ$U.!~/Ǹ86}2N@4qƶ5'e,ПFX5%!< ?u%-vGEz|be<̵C?<WYklI7#k$ꃤ &A=C X=`SZ֖IՇW;ߢ;Zc*wE{u^1-.<z?Dk^Dü;(DC'Z$F%4N96gѺZ3p~o-« HɆo,2 OcI<*Un2| k CJJmb׶a?c9w Mm@cfR) )8:G-%xW4|nHoELk􌉠lh.x54/vIT0Sf@!}Mfp˔l 9w֛ .y-?5lm7 _\ZxwrFMtWn#!sp?K(b|BoM@JU; NJVUIS*TCY-iF~E7iw~wM>O٩g!u 5R|nkGq'  ZA:Udml> EZ}~-d>?@}c {cQ&e/CMU^Iqr*J1r/*OM}ΩÑˋdu oїVYcutef}fP F_0Qm*.?Gp5ͳ-.v Jg7<;״%\HVMMkc]*r(K95\NiX͗QhA\exUw9ڏc76n2ca2Edk aͷr,2O~ 8za%7l K0'u:7ݵ@?ʮ/ɩ5I.".?CG }9#I-]^?9̂qHep5xNH wc</읭~{@Ѫ`;I3s}q'7 !$ƽ\ִ0p wH5O&XXq$8օ sY=I:xwLdkVAwL{GvEc87y.sH"cKe2W붲.>50eUs)f+Mi2zxV&*%ڀa0A~E-WU[FYA7_a/Zǽ԰gI989lO I60"fTx6'049:$/plԈ o䱹;{Xڙ5eJX{,Z 㪍v ܧi O%Iڏ.SXZaxi} i?7܇cZc 9}vXk]'W}==DLËwPrZvةhQRmp^}7̅.նg]5d vf:n{-?R5OOh|Z*ׅY;iuh0)~FHsS{9H**SvC9RNZ9mm?JV^A3]z/`x'5mʈmmb9mdVsۍ03ͧ!s40>i#SD[=9}v$k>V6dlx*qt2>BӎLS m6@|X=}!eKdNݿN2jCs@Rˢ[ik4C{֖Dj Gޠvs($P}? l8@##WY9Z_KOuRu%==Jʤc2BV̑~#v1IIMe12楌ˋK+w4ưa:}VuV& F%2 -+C{ Vɮ?%ʭ ymvC]h?D<4vkp1u}*mH,kAhGcq>)_ZkfCA7 AdvZO!OnR-f ^V~8~o;q\mЇbY}/pָqV,8hj 1&kXMdd%]lqonmcIdrt?Qz}@y>1+2 v0;+o1 nSA Ie*m{gh焔ep?H䥹kqkpvv,ݶ5{=Wsi%': ?*A:BN=݈I {v}?CakZ?Hjr-ȭoP?yF&.΅;HyN,vJaHwIKS g;k1[$̈- . ,&q.R@u*-n3ʖ7:wNϾx<$v v菤vp?:w*#υ6Yo;ƯFų#g xA {6!%4ǩs]3Qn ZhՖr܁c{Z;*x;?to♠7h`Q;^{ZvtghԆ&G&v9ݧ_!p+ᡧ-] @pwVPu56,:B ߲o`5('lpsiucP*ƒ\(7Z怜g=ŹaQm6 O! ] {l#IL1\H]xɫmmqfhDY^#K@v-9'@Êm9Q+$;]]r[[$x 6=S&[Ks*&*mc>P.,slc5=zOpѣcYe{&@pkmw4X͠J>J=†zl2 iM,!Eqd7ṯoD~Twk]셸p!?pxP zaN[L9k+BIu]"G;9 Cjv{?S <;+l'nseǂ1))co"VYi{Ze:U:}oX/쫂bXv+-@?r[29vZXv9h?<\,}cT5ś^譺f]UPXPx<Y{@$(:4n;q |R*gyit8U{zmcϗZ9Fޢ졵l䕎" ܀OSvFD+<WnqQf= #kgDVYc'M{M,:4 e<8'RП+<`#AGtP5 eEi?Hf~rZFˉ%ZtI: ({Á+!ƶnIHsa-nF',aHOV͗$ >Nѕy7i!EjO<)x:6m0@ ّΞ*&HE}:pHJ˝Zg*ns +MHEMMk x;{S{^<3gDp 90#? O$=ҜdSnʃ. pw$R,1{ˎ>I3d )sw˂+ZZ${@tRh'8EIi&$ꏦt;3m[Gt2 *5A #U6$F)'JN2k A`Gt;CK 8vH֑i@%4϶%+7i)z+q3YczLZ]it! ϒ;Y]|Ł7TV]$ҫQps@Ϻ] nxodg:}#*hq>!Q{X!Cvg6Xpc[I[.]{?Kd;W5FTeL#O$$5_JX'Dq1 =}CoO~M#M?q GrIw2'%1W} \$.Ȧ1iYaen h7#Oh#]> ǻ^JF sԠx!'M°wAapR"1xw{tNƁ};M0{8a-Lw{VAn{}(4(TV9.0f)}&5 d8)kʹE#{Uqi'g;It<)>ǁRkj/B{,y{H=["nP.&:ƴ8k%YlK~mߢ;wQWk`$y":vJN=T\MQK(Ťg8ZX 1\A?Oղ O梹@1C- oFf>-肚T-s3Ui}4 kGbs_xoe՛t;yNm0 :vQA5LH"kKu [h. xgkhp'l-sTa-5'YYv6$51eĊ`k?xSgP.~kVK+ݶk/?Hw Api KuhPɟf`!wL#W"9,pV3(ennʝTǼ'|7ovI-p۩K .ѷV#45("~;lޡ hG5Lt9e[9N8r='{Q'Q L4{%3c1bbi~C]LƮE"K9O5XfLg7̿P|詼H{ ᤴnF̲ a mj7ݘkuݪh;ꨊ7:SG"Hh!\+^kqo`ګvkX I -6nXkaВ>\:K0S}hs+%hN7)5l2 Vy!E8lPmz"RQP*VvYJ07۪ӸJ=Z5js{Xi (2xՕ{vj*Uw ̦qIB %BmH9 '9@lb0`b ;՛OPQy!i[b`pUi5!;9FT;$҇ ƉEuܠSU2y'Tel9^U1F3TxRNcXI$I%)$H)($I:d%,tO IJL$;ӹNBxL(+,(1*7's\pT PjPI:PI$)(I)N tHHJ]$I8H )IR(JRI4&N%):d'I $PI&I<% )I$xI%.d'JRI$$B@$$I&R!D$II$I$:I)I$dI%)$I$R&NI&N$RQE2udDY@ER[D̦*!I&):dIH %)2t))IK$$LJRI$$IJI2I&)I$$EJI$I$I$I)$I$IJI$I$RI$65.vy&e)p^~C@~x볁$4 [sAF'ZA䋱iQ<ǰBn 532XǷBt *Z~D!G Dn@ACma#GiЃ )7k%W=:Ǽ6[#P%n̗\ y}56fZCcIɣ4w=<tpe5-h}@A*as\x<eA tD6?  hT% TA;A̡Ys--+5cyQi)ƿh'vw>4㑷'ˎ~ŸNFQzvZ@'k5A # 鱺yW܇P;F0Ne̻Q؎60DTp`̓r'f\* i6 ΰWݕk݄V1K{ô*5cҘ44 *j;֟Rs3<+y->4oe?l{#7+P=]iZ obͿCCx )nc_E4;m l*5eF{#GeOigY?]swV oRcdA)08}#$ꃝSbSg#e86 вksjWXՑSՖ+baH!01ݮE 2 --:N7\ִ[PpGc߳QȺ+ ^w-m ,<ϴ9I-2+efY9L{+RRh,q|b|oNl"р.ɚ" ,=AG?*>Y }Mo=e;>(nsݕ aa6rC=g5XLZ_S7=r=ޙ,Giȫ5=:yi,ʅ@̓c;K6p}MSE=\!<նt[o~[.S&x_Q~o+p.ڕW7C9E-lݔĿ{G$ftCNLa%nV!.B*1L;vm&<~PpGũtJcXkv?=s-=5Xc ќ x<$ܗo^ 5~hK˄9J_jsQvLq >'\iV@!Qb]5=?ER}$ͨ<g }/V A`8wW:*9YU?W |BFH pYy4x)VSNa}2@[=;"~>&/`ZD# uT'<˔ fmll s\eqǁG N>@}Bq%FSV#mp:#*%ҠSL'RZN$S'SB'I"<Ja3*N:E1:9AJI$nNjHI*I$bKI NxIJI$LF'TI2q4I9 S(}BI:'`:(I$`R!< $JIfTpBI$4''Xk"O?nrf0pS5 w=lTA 6x'PS%dnocрbUo9ubuQ?Eh% up2_yzOnR31ˍtqUr-{>cVp켆Dn1^\k@YNN㵎;M/paBM/|=xT8c/ [k׿*UFfOqUE%cَc걥û2$O݀?E;iиGIMLkv&=T/B= FݫGEoQʵ }gZ QA,hx2Dx{22u;i3HB@;xF89{˴&[(8nyZFXaFXݡH89v O7pSaR|l\X䬤Ps>ev ge,ju`#lZpMcvOFZ}(6?fi/ļ؝;pq 岃}%ޏDNt[?6[Z59.-(@~JJ]ՊљiC}WYyWs@k`?$эwe'A?  \mЧEF4|PSև8IGwLY#FLoԚ1|Iyٴ̴~m Jb g@8*M` $;c\cwVQS,zLg1ב֐ GqV%4c "\=t@ CNNUH;(ۼ3 u~V:n[K,69mw﬊XNS')5G.rs@1M4OtB퀉TkNZ|stb 3/259Ld5u3eR^,%ג>3Ʊak y&O[>XKKA|{ lwRusH6b뱶JwVSq$3~ޘv+VΧik0]kC8Dsˇ+GPH{Lgic-[%[p1/Q.4LIOfu'v.Rx&I]mV8#!0 8)[em-~ PC[y`Hk*λ]ܩǨSեDa)a-ZK'{H Gv))qc{]hi;yOg2 d0hi=O#Яcd_ICsIYQ*V!IߧѺ8$Tu;*Ъa̗o` Tv LYT}m] >( Dp?992wPRs1jZ܊dW#ZSvEns3IW,&]TaC|Tw:ARej#Win+ <7#:uYd.m}25 ^r ˟;KP |Q5] FR1l}"эqc'FApD4iQ DٳVC n`7)1[Icm6S]eYלe o;{\h֍ @~> 9!3^];Hȷixq?P"~7wN+Ǿ6?uEP[63o=2<DClHq)C4Hi b9-\<'r1+DZ̭,I=ՓkCKR<·9Ru)[xS)>8xvPӏRK t`5i5 BW2O?V1]]Ѥ7 $hp@ 1ǴAXxS42%)ͷ hIAǹ3ipcu/|a1 S]l$1.=EAߺ *[ZQzKlyoUWns[7ջk)s۷lSCg)"A %Dqg=3t3s=rX4LWHk-as,-?UzV##S;a{uڞ`ƨNœ-ȵxϹ1)lG۹@o+UurYo{%잎]ZVg}a!>H>0g ڵIMYolzD%V-L H>+ہqk^FZQ+e Y-pDCieاs54OyQ<$@6 l"Gi &]t[e7i%ux?r%V58 guIĀ\L椦f%^tZnGkC@prche55/1RNV7v x#?fI-!%9Nʏ`H| a٩k%ldP*x p2_jU, mu۲%;I;H)enD_[}0UZ54J6]xr1--d8if㺖[w~;-ǒF VysxSh/Js宝N ֥ ﳸ8<jaf3./ѧ@h4Ec &ZlhhIHs )e>^5X^ֺR 5ڮ݊ks-?F*v豠C^>v$ԨHF5s=X9.&mƬ]C kHK?KD5~KZ`SH.l s)` 4%0~e=yut=.{)`Gt{U~ϸ;O빨L—VXY2 %2eHG@oy{bV[)am!3Qk 6΀*5NA{fѸ؏767x`O{6[r-h?jV.ָhfYlm-sOWe.v$)`Rn C<5IkϹ/[o~ѭB[ӦqcڮV5u.M2@/~٨1oo'"ZZ{.'X%L`ۘ;:v!K){ IF%!e^ nrDZ `> ᠅2ƺt6hUª$bRá:hR|h8,YYm*ֻe [ h( Tj[JLBrR =Ri &i|ٗLF# $T^R&F֦nqdPH=w6ǚv7kv ;JaKX1)$X=ߔ<;'RQ~H  hOo&\k%FʃT2Ͼ$>" 0CuQq_Igi*x8Gk6:wK?<L,k)dKO)?-5=IOY=kݶ{*Y^1KNK.>F3-;OuPaWz߻?K 'i8j5Ul`6r%k;c|msyrS ͆tj}'TCd[$[r.:Re۬r.^ 톤 e2+:f ^ k*ծhY6L4sDL`h8>{k2=h)8:{<u3unQsC>Z$Rqf r%ndtrw>(`1Gޤ!E7u#IP7aOG{ W[w4)9LOOj|Ҙ䔆]|>S$ӣ55 p}"4 I{H wJgeIy!ƚ=vG?(7Z[\}( Qs9n Ψқ-T$e;' nK MFߜK3?3qpӏG21<RfhfXx '*y\F,R}Yc eH !dC5LYN ᨑSq/$ṕs{@ySi'c}Yl|û8AtSf-е=L٢*H9Zw.NZhm\} IUw4Π?A9md>j  Nunc?Ccv湄jVv=N0oA&OJiQ4=ы05> nߦaȩ/։t[,->,\-Xq__s7AQ ]"z&ƍA9yc=[^]C{o~p[ù涀rROJNXt)5`hRB7RZ DNdxrXtCdӯzV&ctwI-6{`8wWmΧhfxi>ks9mS'4$dQϒS{$1Cq)zB5v 6:Ck<waڣ&u$($ĖY5p2n-o"VK*~ݿEnΦ5"gVd$FK!H8Nz[w:꬛뺲ݟEVBVuDe :{$G&]F)%Բ.% l<JGP lӏ|樾JD8$s=$itdY}sl?}FZK-6rFlX湍:$nx&5;-U?Ws>Ck]|}Yv"jf/u퇞{W}[$mڟI.a$L^$K_aW_aWХ?X?#'V6kNV6cN\`tF u +׀U~Yoȴ:+K //c@ )6] hyWo$J~{o %2E&9J 쭦JUK!Vc0fઌyr!m:/lfy-djOa7@}F᫑ q[Us YʹCtY 6)Ѧ5l%\fi G"5(R.ʩJHN[mlVlf v״) REV`4E۪{+S0YPVUj]S{؉[p^}fT7(Fim5'&]Ep[uWTIT\юI\]ߙ0seO7!5t~*Y?A6_8p-}pȬ!N(JqCd-XUqdWjK715$2u >uͯNm)~B%̃))8nj{Y"BN !!5-;jC "%:PI 9)QQtAi݅EUI\hVӹ DݪD.M;% TJpWhH O}[V!IaVLem)&g ܜI"dILBJRR$8ĩB%.`4B`KRI$M𒖄@L)*NEN0$,TaHS6(J)U5<'I(JiIK$$BB%,$' 'Q)2JRI$LI$I"RI%)$JSJI$$INJRE$C܇)JJY$"JR)$N)FRIJI$})$$JRRRI%"TJdRI$2t)LJRd'%0)RI%)L$tNI$$I&)$NJMy (' 'LNJRI$$IK:hI:I)I$dҝ2JRI$$$IG#]6zw?&DwoIL>4 w[c5ְeMKѝ;Owp6Ja{6i~XSA}?9C%H);i9RFB{KN#{Im=Ӑd.$4,j1SE)I$=bZ7:UdT9 MR%)'!Kp*!}ZT:d[?#hRIJJI$'I I$I)BI$NQ)$N'JaJRI$Te%):dƒ$$IBG鎨)I$C)$S)p"NIyI$4)$I$(%II)L TI'R 3RR'IL&: I$RԤ$IHR삗LIL a%%)$L5H)1N#R QYxL+kUWd2]&G EkbxU2p@0V%Q"gZݻP5DC yLݦ*4i㕹kHvwGU6֟lm OU;6X$!Rc\Ov p+VL16L8v`K.ql*mN?{1=R֓CMeܹ"Ysv&4r.QX[d iߺ i`eW]oknp;:EU2fy;j-1ᶼoppkΌtcH06IxUai[C Ac;[k8 4p?Uac^'dsZ?E5];"MŰ@mUxP8m>nO ȭè?G+ګ9 ]?cj_+(3e 6dFE1u`cpA°exMli >@{ ,tZhR; k(/uXuݻݷt9ȵR?Ky|SIt>|za&-))eFbsI @L=hhR,sC5?A/}/F=\w`@Q'Adp:э8/ꪹY?SF̆d9DZ67]HAj~!ۧ"6䠽l?w5Hk4V`@9빮Je\mu-գe6ޓ ksh+qtaܢn},pȪKQlg;?uUF{Yf+џUɵ;O6Տg 0Ioڈ6 jn'Z[C{%:;@Dfpyݽp*ߣf iʮ>'duCç9y;1E5|u+ %č6[p5pQSr[FVRaK m}qQ~NO!Z~FC=s OӉx%" 7a#[!o%.0佌sw4yvYX24ktjGiyg4r1p3A}A-gshۡց-= dC,!p7U{]m`I,: [?}Amswr_čvNcGwp+$UW/PFOԪ{]5psDn3{ew~z k;?;Dk(đ<'-,EZuj˾2GD0\a,dO< & IM&s >N-fˋP~;<FΔm)fwAy$ stSTkMğ Osߤ!)ꃽ yZM$55RmC)d\roءxowS8N;Q;tTsva۬d U6ĤY\5v"!?irV$t<;@Mx}xX t{tJƹJC- .lSWUMY_/+ses-U=4$eh'1r ˌQ% -NL^a r뤶IpVðݔ7:4:vnlZ B=^]qo"N!#k"Rf54\lJ\'%%4mD6%]?ISs}H[lrFm.s{\49q#{Xُt"O úM`p⊙l˥KZ_ȿap7o{d欄>;/~ڝ\/sb8dj4"TK()m$z.ܫcd>1-uMx^\:^eWR kğ):D}P X}tFc'B85OicwFb+ϣcdH1=Z;yN$`7$)<P ;$šm~T)5cgSYiY2 N;X/q-v Os?ۧ KCˉ{$&Emm>Л2Fc,?T~OY_J@`1$T̳) QDe=yY ‡5s vKLG%DGoPw7JodSk&MGYvUIK_;qH qO6C}+5 r`3*,~<ԚcO%0+gr C=8"[:kێA6ew{!}BĎC N;t IL;:ͱ ?;Pnc݊KӏG&7ϡBLL̏HwSt}@ Qs!6c6q(`7$qvY1j͖=e}OX^ NZD4'> IDf;JZ;XIus\Vi&kj,2&1FڟIj"CdmO➽ti'p;HAJsst>(š3[:HVhn8X Kil'PT]\֍ x/<'OMSFڼkG/cu 3 [ K6'Pt̠Wg|cNaq0GIL7Nr5}{[-zr7cIua,1i;s0B vNP7~jK?zxEMD܊+ufZэ6=[bi"'x0XWUv`!|+?ȅb[ܧ$V `⒝Y}@| 7(RhCީ6PKm#F(VucIgx{بtHֻ":{n3{z/|!9L_@x%Gh"$5 {:pyj9q ' oslزHO*qq'U]"ѹº}Dn\h'BqͥPs4 #ɘy)5 97^@ľ9Y,ck&e?_Y7RC{n-f@(qH)zi~>h$K} snt;p #cgxw5Mahi?Wku!DSjk1ܘ`$vP)3|]@;lV ^'B`hu0I0A(wzK5{AWCij] U\V˻4H=69hGxII/qD 8+T`p{]1Ť`XR5U<%X h]lA> 35nd N|Ah"{qE* 0y"7A(WD R&uM'<(gOc@pGHI%v)]ƈmp10֍]GdƊ..)9LG*Y.I^شjL 1{Ld'r(RcDFq@?4F8 Tp4$kiT(oʑwyIIpXd8 PSݡJYUCyBen(o #Hwe#؞R.䒓P%cOF,擼T =7$ Q~ ,)dw )l{F?l !ʅnp-#Rva7h#Oi mvAc чܓ^7kR ȩ{۴nh5 JClmΪXu= pfHwoꨏoI|ș?>ӧMkG$3Hp;ٴX#! iFۭ l#iBnS}c{&%"s͠g}$,|Hz~k{! ѣ@ˏq'L>rdKxQkIM%]hڰ5C#~ x#mHĦkAʋqH۴H8=S;jq9Ss4x*uOlsH/l`0 f44@3I|INx268"7,<m٤Mm̓7?538Q1CjyA ˵EK9xEooryTK nfCjm~jwLqSs$4[oĻBjCEɩ? AN+2$q}^#h1}XiXqo7jᢃYS>\75rcIA-}!#;v5꒖vEac%*"t}lDk/u~$&LGBL&;wwv%$ h'L0li?ٚU ,);FeH8$ Gk{]F7mN.'PWSi,P;$?ةð1+2{ȶCwaYC?h{'c]w;<$IMvgs{f^*YQ y>R>lX7L5PALl57k'IA ÈI?SĮC<*n;Y/cͅ`Tm/|VˋEJ@ X!nhte#RB Kpkq0dn-U:{GFz_iB"\] $pX=X X;I+b8K.ew5 Z@ӲbևHI7w!4/إ9y c%i#E4:˝Sc u Ge0R oWwR!:R- 쒛0x V=2\=i!1uUν] aۣp_?3*4`;?#)V7ҍNc_ޟoWƳj^l1}&/*űm<}^yNq2Mm3RI%E$__aWWb<ʽ 2+|^崰7 UkcU\ טUD0Z´zk1ۻ+:Iz#!YOվ+@}؄A*Zh-v4^N"FM-Aׇ&V‹X5vDn FE{Nچͺukٴ5Հ/*yŢכ }j۟"`+o~hcc6*WV\T)ii3}4Z5SRJڙ ک8\͡() @蜳vBVԋWaE /ka ZbvjKm!CYb U55Y'G6o.YvI[.իdRaۅL&nq)puk60PjNo~C@B d;ڂjΐl1`7Dl+$TeVw r^0?2kn-wD?"cRvD8bX1[:h?y6حU${d #Kly{LP0ϭ=z>)߱c !wE 2{۵թBvY,qK7T(w/v:mU ncî'y4A;JNI>ߠc$Zy҂Vg>1 ]_Df&@{tZٮ7T@sNF樝[B8Ȟ[FT›=Rp sk-zVp[54/gM54:vI ?Rc$CR0tгúJKeT}}>}MCqag{ '#a-lnoo(=5ͼPf&$Av̷T%%6ji'}/~-N .oO"2Y)ũiAvl:Ot?5L?D)6S[YFvMmV85RZCݍC?ʟ[7Ѡ}"kEi,; Do{$&. )| vBfY9g ?9l5dbKo(2Q=IeמOkZnOKs<Kf?AзBΡKF֏)bɡrKiu0+CވAEIHJo:mȸ;Ԯtgvhkp:uԚ]'kvtScp? *6@[׃8jJAUn'o?Tظ{?pwu`?F_N᭧a,>xY8{c0£cT2 }?*Tl}v~yy(xŠzl!'Mo/d> 684|LM_(>77B;nNJLz̈́"CL8 G󣅟;x$]>5:mݰpW{āciy*M9QyXiEP-:ٴB5)ڛUJ,RRtXTopZXI2aM)}G)U)$,-BZ#CM:%IBR\>): 6?o%j;HH9I11)pTjHRI2bY&I$%bRRNDܒEJI$Bd >E)$HodD I%8J"||BI$2&IA.LJ&I1HM.I%'R7(I$\' )d$h)"I:d JiAKI\JSPJI$LSAJI$)LIRI$)ˆR%)2t@$#p($J'D%)$IRBc)-%I&N a$HP*L2] :a EFV2F-v*o -+B7\Z>*ۄȂ$-ď{"Z^jIP3eIj4XBZւ{8}[KaMݣ?t+ͫcqc{h|P>4E5IQeȻ+1GD a^ۋyhU_9ЏPqX1ԪxaKG1nf1Rqnd w3;ۿ*`ipsb? 3$LQl;Ws|?9![Z}8NR`ha .%I)-W[ym3򬵐h.?slޣ>՚mmm=GaHi# Q:5CoqdTCVVSZװ:)z<U,)2-:}Y./kse7Bti[ȵH-mῤ vwC䂑`n-gb[,e;La>ՍKYa5#{A:O:EۏpPv<h`6ohAC R G=ի4QrA_Xnl륏]a-qwW0z{kyuy% !7wwNC H_ߔ@K=jOtTУL MnO ׂ\C8?Z qv(27rZk~>,Jp񠍾͎ ) ,$Vbc vxK% Q`1ȫ-ĭZZ옎 u 􎤤EV~x;ao:"5UI1.wFs0&~Aid68"|-L4}KvŤkQ0U*q`\b,Yu'kG Zź*&;-&8{"(I:~OwS؄ͯݭأ2:0۳o2@cXavڬ_+/}q܄@9iɥѸ@$4~djm\֖-?U2V3kC_H7›E.v~F#(  !#Lc8H >SU[ ,YEHi5+0M~Iɤ[L?P̧װj\#};e7#4Aj!>Hx%~\cl ]6I>^|J~60@v{el{s?OeZ÷`iQkqLva-Awvԡ m[}Շ0?\ Oj{sMo9;GVhn'nGikN'Q[ɍ4N$և @ࢦ%ֺA8%( icyp:[[,w5:==9>G`ԃ$g9 TKHk⊘6a>0 ]2 ){NB[ٸ ȨoF l-2Oeڍ%v@-Jlk=nǝ@ìomkZN膜z G?X]$ktqR{]6Hth U9F&}tUQSc 4$~=4 uEY| oRFIאn ǘh>E'|79ǩ⒔hnutAͮJ=qN8lMW`HA t1s?Qk[I 5Y7JcY {q2*q sLn%?J6V/ I=[U@ 5'aùVKHd78-M˳3 Kwh7{A.}sȍҳE5͛MA?LA;Z1.L,MJ׼X'cYŕLhQ_kZ\[L})=;l`.?'ƩǤ}=0Á>Y?U_pkAxJ|NOQ\R?x*8ym`|9kejwO<udZlgg3."ug`]#߿P}F{q4,eA#"%?y/]9tJ Ap CizDz#B= #)2ѵѩN97[C6bSbqiʋ=]GWz6HH"Z[Lwd˱ԊoۻyY#Kc"JC/d Ҥ4v;m/rksP 9 } r Zbn&-sѮrV@>&Ļ.5wQfKb׏UhOe4kJr%6Ƿ_5;#ZA'yS_gC̦ mlcC}Eײ(lT~An۴Qk{џ 'wQi$AT^ZƆP$vIMP*Nc|}U^8L[Z5 >urv[״vcxHpX f64!N(ĭclA…{ (\[HPF-Z't?5OԖ y8Y maPb-%$U gFZ{%uBf\1v<4H_L\vߺchiD;#vV}=uIAIkê;5\9T1k6?FOpl>. XXC4c{f(>gA! 0O#PQ+ĭk;H )&?O4A!_-}o [v{\7!t5C{EvDf~> Y^i5ȒL+xֿ'QeM% Y<YTVULP6dĀQ߾I|A@Bh`$0>oGh&AtU{@cςcֺ@=ܡ^{G?HjSZlxl֜mCI(q;ϔ\LVn̘ImdN  oԟqQH!اp;KLn;K{$Ͳ\p/Eִ:AߤkKY0A42eeOl`UFˇ ;\|BqcQOw7*`&4Skh7V p8P{dTCDZΩzvO,N;p<Y5v=ǝ{ʃIp%lvKsĻ悓eb[v8iŠOW]EndEjMb-%I֝ɚ<Æ=7otLK6ƲYȦuy6TY} =PxBgU4ѕ}&35~øwDqql,|Rɔٱzw^8h"?Viu-0?M{}<l)lvIUQΰ3oH*bmB|TYTU۸`aͧq6Sn\n s$m廉יAc |̀@J0v{PRCR~On%6ӷ1hykH?T%!HnAxN ԍs:<Є f RS\a['k\l?\۰N;Xguuj}GK&> nu|!% g[]\F}PFVek~L]8ֿm$:rt͎wAK̈vl"ɶ,ߜ;" jݑ6<Iؔ^ֳY:Gka,BdrmD% ؀kL:Aײf]5H2ֶ\iJnC,gk?C=.H'c)dmP]}m{?ER'a4y?爍{$3vDvII/E o5[;xHSMkGe>GS)8W[4P6@O^q"?:4mRx$Xbǒ#&r_CrvX'}Y=BKG qdjE2 JԂ3se:;D 3! olǰk#]FE[A4VB&TkwQ\#[R@ I‰S)rum~E `;(Q.=m|C&kↈ!g4 G ac@> ơ? RR'@4d/[Qg5l|S8y CxEL#iar vD #df&$@TdAILk;Y B9Jx(#XF봈*/ӤL{Hԓµe>\K <'ĞU\?E{Qj=-cEL6?誢HImtH<G`xwbaD7K;wU4G9|T`4;M;ӭņ@3T7Bq?b V4JlcWfuUc\lA"Yiy'ۿA=m٣La׼F8{RSˆD>Ь9֚g}ʦז{ȵSi* D/2|2\= F);ِZ#_Y W٤G `ݮvLۉ:D:>){u)o5nrkƐ?>u {Y,2tnۀkNH)Y> #Q U}O%o;5[SHQȴ>n1w,I E{f">*L[9HA$O*mՊ\Cړesl 3XakdqU G}y(-=ۣt50̝Q8Ʒ E?gDLS4L/敭kX7h)8c9 v?b[hwϢ qxVs{E~4=*Nw`7yVV_mGU0^ 6zM9*̰?}j5 wN5ޡ۷M݂[{wd3,tm[ ENagWS1SzMsϧ.djNC`cSȥw*~ W0+qQm^ >H/v;]teY]/-d;@O5+DH Zs$SZ\YLU6{|8;k7|7_x`DR!AP!E!.DwII\q}3O<ŽX|iqFgpv*E_P~3v2,GQlI Z{ )hw6~a4_Pk{b[)XğHvT,c\pqxe}{Iɠ 4<cX%Zȶr*x;ZHZ;(' LM3\ޞc5m$)X8T*5eL0ahK-$`x Ca D$"V+w:Pc& j'}yԀ{55,\"yЎ)[vyyQmE~z98w}nH"W07$d$ ٬RDHȩ)$s 4&lfpv֘cۤ|[1dBIsu~?y;C:ɜLǂ:Cu=>h);~w%JGLa s#;YMY"?%]w9EWoN}&> I$ $_aWY^w??*w*Sk?Jb}UdǬ嬱3I%DD!FgEq @IRU* iq* *OtQ!5 HM9\XP-kg̰51rr;kܣm[yH, V >܏OkPw)$ڋ#; SYrPpPD.$)\XTlPsK`)_ԅ6ګأlbB(l֥0PzʋL#ݥJJAr+(BVe=%K] Y׭+ jS0+a!!^V$%1!$铤I%)$NI$I:dI%)$I$IJI$$$I2I$I$I$$IRI$$J]$LI$$I$I)I$tLI'I2tI1I$RI$&I%)$LS)% )I$0PQjТ銲 A.WGRI`PU0J@) $'JI$F %4))dRI$I$:d)I$I$JRI$LIJN:I$JY:I$I"I$'I%.I$I)tI$铤&I$ҞS$I$II I$*%:dI N()I$`TTL1Rv oPI%du&r>+:qC~ [Q]&d,x^WsĒ5^8,5<`L["c0~I9}$ QqoM5$2#~W׵x~pv\6BfꧬHEI:9GvQS+nuR'kixK/qkZjn} _v:CT'tLL:uQK@'#x6K.Zչ?H}$qUXK#S3q.fi:'lm)p~=ühQ0j{AcK};xpD.zv sΰCަ>~q5}?EKE >*HD{ZH{O`;ENr#Ayc[dK4c;m,Nv3Ve ȬK|S`c ZOUly.Q!nQݓ] $j bpmRzkmmF\w7D{ʩkI' -q8w-llw䴶zvT.7h |P2DD '-hd+Y<{yYwSD9 [،=%SZW"*md)a%+D)JhLL!mKhV[X(Sa$˔ xUcUr F80SbR\-|=<&- ѡ ZH4BMuBre:/&g)$D'O% ()$)M!#䑑Q5rI$☀SI(btSQ> )tIGR7<%><$Ip#IJNIL9I3R$O vL<9j$tQaJRI$B!@HRI$s*I.dS 0i)vRBLCP`'RR$qg%0$$I(NJPJI$%HꂔI(TR)$H%7.PRI%)&%IS<$$eJsv5FWHJ%{KK&|PFHtRpT\a3]⩐"!@I RH5Å6u I&LItЉ0[&|{R IZX 6ZR6C|7[%tjqg9,,$Ya%B vm%7XaaEm54xRY mUey,\׃|_fqT7* %?3[f;bIY'*O55I p648k[e|cHpMSZeь ilhPq@'*|7*vj&e W[)Qx>~t̼n;"7H(KQR=/hCO"*T:BױsKO&mx$k?%S󶶖iBgB(q?J6)ͅ"%%+:-ʱtWnd4&v2Ƹ9<=GV_6&Mf;+/m4NJ mfEtYk˿{][cr2Z]sBMneU'}z%LF΁In $g;rJt_FI6S*}Ԡ ]j_aaW>࣌hpzv 7=F;(nӕ?Q R~W.% S٬>"* <l 2ȼ9h?G3mE_Dr !~p쇽ֆJOMo:Dl:4PYj3/UdcO7ZW{LD#;4OVw))GOۜfn( İ˦t}%:_mw;w)M/%k`PU-vC)ʀ@R\L+nzm17Z,4e΄,١ս@У'&3s#&Rw4v)K#d&Xہ${$VdRz@*?go'G ҃[m`cHАdaoOpm`g%]-=|6$\;Q ;"WaMuiP};yiyLhѵuXùqT levV]i>'?, 0'\憎(>\7;NR8\ENlnc;z[ok;fAdUU/}s\ Dzwa_@3Em:@;;3;; 5;S?H1o^{׻ίa{=< &?˃X.ޭ nnU[Z'qCv#xRH7p8Mi{/w;(ѽ|=wJiz{04.>Sm?f=deG$w~u?J} 6ΏUj*uX*H&c[cllRaN7 s`Ika%$1ۀ7m~l\5?>+.NJ%Vj&D[!=k<ϵGt+湬oRTmfvEwj-2͠>G*tl;G ^ې/p)}78:{ cZ#QQ+lEMyi}F?)8: rEi5Ou*GZ]N%⛙b^ Cɠ6H?)0AhgWRwj 3Jg4cG"s.xu}?VCc汱^<c.;|Bk^@x\7yC;Ax$M"4Th#i[Mn}.\XTZN:~w򿴫C=W05ݜx*6 c4H8}:щh:Ƕn4OBfV5m)FDSc}R,mnul>g2ü Tv,6_n6d<8@)˘*s{ 4ܬ ->\wN[xHEx涾ۋ\Y:Us.(;#7)e )Ꝕ?BgF-z*~ 8vL~i[z.-}Yk"R-"% -TiZ?=Rа~H>="Jŏ?A(`[h`v8k#v)h DŽ@X\|rv\jX<WS(,l/)FȰst즰-j/ôi<ӽviяxԗZa蒥[I%T}Gu78?E5d9&@&KUvXw$>s?a?Fl5-p-JfdE >~Ub᥵0GKbc=Wɝc*.v4 #P`"Pl¯I0Ӕj:7G4ǶEN՝^o,uC]IoF3pJ܆ǃcP3_Et"$ˉKPhDn}chtY# RpGmvN_^p<;S{{JsQ.:hyGըK;gyZ,FsEƟ?#Dw n.{G [Zzdɝ/mRLH\5}ӂ1ɨUHs8qwW m1 j<^fd11ZIZ5;BxAi ΏQ(`kC҅)8{ȯ *Xq/wm}w?Ҭ:EkySu0>۹I]#ú`@*D;M%=&W=ߛ9ĦȾ[^]DAtvƠUq{ x(XC|q.;\viRk aFvW$4t'}T5h-#Vb55ĹYk{pZY`wtƖ]ԪHo,H5$?0xIIeNODh|}}`@ִ B"E&GjNZ6ʕўL${sv2QA}8\(X˲fƑdV8HsxXgN4 V66c}X?ItI)#{NME4@臍o÷w5*;${D>Io'GnC;u}tok_:lPq --Xu!d(UtBM 'ɽ/Lb].tCh|T,64?Mْs@>[QY5"Ɵ\W@?@#1o{DiD{vNI(}rt))Ϯ8~Sdc k+{)鴴3npվQD(vR-'V LL8/$Գ-L K05'+UY]^^EA‘i$~piŬ BsC5:G#%o;q삚Mn4v~^o&ǟ Pg&QZ#AN eNovKÉ.kW _=K1ߩt+&=M~#7!I14J<(Cp#K=8IL(ƺf);N j%n"gU>:8% 6cM#?O%(=\wekuϒv/j _Ta k3 *A2N#am .^8k.sֱ}e65wIH]쬖Pm=ONmC~N膏Z kO;f;07j Oʷ Ti/[<+/>XAYisN%):;( $INsli Z`-չtYRdէ3&M'WWȤ蘷pRk .aIM6P]·-:wOMON:fߤAߺ0AChhQ>ؖw9ʷ29F\OR}&L5( D+wHr2i:Ӆ{!ʃD thL@EM*.8QL<`ݴN(J(]XTA$ 29F\O}6Fh˝-e;vP8ɑy3OsgGtu6 5M~=c}; -#Ea5jD]~IPn0~c놝'B?wT-Ѝ|Tw,q#%JbǒyP/tHnIΎ9t ngȕDSE{$i}{ȝ!E_!mnAHY'ot"@BnoIԏŒ&\̈́ vVzuE;}cGIdl-u x.=k^vHhg*A`sY6-Okɇ~E[tp옇u21Piܠ>k)0m΍VgU#cU^ļBmhiReqS}n~H5{NnߊU>ּ6?GɄU{*P }IT=?PG@ v{"5T SIScu4v:kÆ=i1Cs{ lܨ0)8wM3>6,9?IQǮgnaJ8ku 5.{&s٩H'%Tnhcj˥N.pk4pa;}wP$E@.SUU5X4֛Ѫdo.Dx$aڑdH ƴ\=| ]u~{6\.w(6nؖ%]m#T#<@OBJl۔]htdx͵7.sV}|K,CoB ;_57;ǵE%6]EťD&eM|9i +\lhEZwV`L4tI60ORSRMQ,eX >f=ݷs%t U .m-{dO՚6LswSOw?T3kn16ua)ϷG)1W-#@Z[kGwW:y!28v D%(}lI{Y*RЄ67stHkg(H&bvhc&uE,[r]f5Um/uoa⧍sYv8JNsd[4Dx)C)git7jiǹ\[gѪn}AA5ꫬ91x/@Q hx?C O%#n>%`6F[`[/wCDd96>CyO{H'IL8i6rv(mll4P6|G'j`LgP\'+S⒙Poh䄍@DH?T4HKX4w8 af;$;N%41ɨ=܈:T1}dU2svTMC78bqq>=4Ĥ]|HY*UO(lOt-L{[#N)5iuYt]^ϴ<KU@ւ ÷e_|WBo>vQ9nîsYDjWAxu#^&\X}V X=~E$IDI_aWq^y??*> Dbt3ҘUYYl\V~@!KrR)*赶%!YnS@!I*UHt%` X ٤+N2Y!xW#dPm¹镍{]|Tjv{U TI4:o<*heM"aZxFʉnf <^,Lj֞S]ͦ32>Hc}n1We7e\WFIZ_V:=8r[ЁO>0nP&ʱ =6 \* o:ĔOaS{6T yV,l] aEK\vNʋH!P@GU:%Qkrѭƪ׵00 IHQGJ])ݎlP eeSFx0RؘUhDr$+@)"S ВJr %`ܣ<:g_&"HUjri\6kuB: Dܙ*mNtQ-N^'U2e-ZuYQXTACHF '.! SJIIP.P.JS ԕkJD~nC"QԃECajghC`@Pw2Jws%dc "7Yf?H+Q{’|)'dI$II8QNRI%'pQ AK$:v6))dI:IIK'I$I$I$I%)$I$IJI$$I)I$I$JRI$I%)$L"R铤I$$I$I)I$I$JRI$:I$$I&N%)$I$IJI$HIJI$(աZuQ,Uw*ͼ*甊JMD)& )BPRdLI$d)$R $AK$I$$I2IIJI$Jd2J]$IEJL%$TeIIK$ILBJRI$I$I$dR铤I$I&I$BI$'I%)$I$ $I'g**l )I銕joPE%` v;'.ih ZGrcD.3-%Zk{)n1RRKt,IX ~4.17#afgj$5ݣ[_A&=f܈7ޔٖF6?r{Ňc]!7(}.&[ǵ޵uʘsh<=8;`{7ƺcW%MB~Z۩_n&vщMƀw /7[ %e Ֆ񯊩sǏISf-1N}?ͧ8iG-MqtTly%[N%I: .= `UƈU%Z j}Qs(cni)^o.Ѣk-w ƪ'R=Ωʯ@NrJ[Dmy?N~T7)& R5DJvScU0'ʈ#xT;^W 9:Jd!I =Wi4(a#H4JjYBd%a8 Bm ]$IC:hT-JN$2;ۄ`|R$aQ#ÄB2I;>!-G?EJI:I4O$,ttjSI$PȐ$J> 9ԈLJ]2I&)%s Rt&r`ߛ>()tI0r:$I'tM$I.~ $ $I.SI*I$$rIJI$*mQ =JRdR !$R'ڝF&:-]4M;Zu*qSKNTidDj&[*-@se9*[1 )cH jӲv ]$ИQ)BsSޗip+bY JiVjkWZ}xU;αcKF4K{<@ciduǑ-/Qt!tjkiͼGdWTװo2Ъe\o-;$/p.m7IU*,z-k}A˖P6fN4pBp[ner\9VP -iy+tGbրKE{G!%9fX`t?0[ =qꝔߏchI`B5x*b:Lˏ!Ѱ*))7sr#h5SYFCËzYXk9V4]>ݿD0sP~SYx=DT=Qk]쬵h)VNK\iN6)YgI}ޛn)+M>ݜB&hա?-c Z;g[v#?PmRG!%5ɣ 1Xh*wKI>MU׊Klyuchiojşbі")S`n wIwXpsN'+xMdyV78Lo҈A-ŨDAMcY2Z2j;AѝCt G5t2Cls7kwq[sc=RH֪W$o_!Hg{?P}0;GTŖKlu?>J'!u5X}B y#cK\tXv棳lt%H 6;}AÐSk'*(K`2KD"akn[P,qS!?kvti/ ]TO,Sqy )N#lf6y|H7U=48Yl{P̮s͎0XAm>)AyrA#kAMdd-e-UZQť}u*zt1ů'!P?݉1ke#oџ$}c[w~Q{c phB:h7]m\( ?H{rqM-ߝIr{:ks) &_A29,On>IФJ! 5Įq'[*qe-0H  q밗5ރO^pv聞G<"@?SݧiԔŸۣثs%7ͯk>*ջ[ :zRoYʃtt7;}P,& h2GcNpWp!y 1ͯÀ%kێwZ@%{AF+m'x& %5wANvN.KJ$O0ܬ8 *Y9Bs?Tȶ7]b?U<y)'͒+0{L= ))Ң2M}Ǎ@~9c,`4mmm~X?447u#u?M8\ =ǻ@:IpMaMNGђ@ ܖ-`=}ʻs:'a AyJoQe@INCOwV s^Kt[aM-cX>5Ǹ%gvWyE2okGԂL2k-cL7lR]84:`o}t/8ͻL58[$m!<)N=vRVt.y6?O@&{YSuk%[c5\YVudb~C0l@N-s "5}H jIH9'du7Hw{`ƈtr ["<€cAt8xB[ka̒/NIp;IImuR[ğ*68i]Yeu9I8(c;*)s1E_fE=h!9Rq.J^ CY77afհ\$@?Pf;pVYuB\a܎˘K`~l|JIe̩?M{a_Gk'g?9_i6+>{ @a'lq-#bC5H))^%,fo37I_ƺZ:8Twa:PssP)6yB{%g UGxAi2QS}XZ#a?Thǩ۝ S8VrZcL45*.0AgDZ*cwokHoLJ)_`mCA#0Z^U wmWgPL:nޙm6plaƸ5Ӿx[  H1"mzJU.jum?坆2I݊Fԑ9ͥƠ>OULhIB8h8x [7> 0KdsKI h/uTnsbc9wcʥ:=ȯvCt'R#O "C==էϼFa#H#ۭexlҴ2XM~>FYUCQH&-8Rƽk VB/{69LnLd5쒘\ ʹ~}O{p T``e* Qs,vƚwoQ廛GޣLORFdn6]\iWMO*?ؔN fC$/KMEDT>hpװ)fIM粗{%0}ge[: uӦu"\_6kL WXk;۫I'AAո{]I%:Y]MXVsmю H_窎n{I=NeE{N5w' {:"m࿞@<xVXl|㙫Q6s(Ѡ{F=YSѪ˟6^RgF䙴:wXw&Aů¦8dgXji) ىs\&U1̷o vtssòq:Цnݜu F V[Y/<}$'9HEs u>pxhE=ݒSM2c?F*˅Rm_WMSYm@YeQ LTHsRkF|@9 r'HU"Uc\Ѐ7֒cW߽Mչ =6vʹ}vXyV[^e:Gu'iI)[[tz:t4_nKil1Tp - YeD =i-ɛh$h3.m! tY2ǹ Q~OvZSHџrlc+%[XE=m{GQc\;ǏGKK@"9l0; >@Xa{ڮk^N:V.'P :x2O#@;x^ Bg]r?&"vꪵi/s?Ys.>?uDIޣ!;\FѼ tp t?B^M<k{lwŤRLI/2IГp,պGCCk?-yրKˎR_pHSQ>4 `NSL&kzN}k\{D@&u'Qm;\k !E=wymE5 jΗql59Z&c5{ D*42[=iSR tS@4E,AM{=V?՞˜eVGr^C. :v#a@3`RU%vhe>\yQ(n (SvDyE%-l/8~ᢟcM>gC%7e3ܜ_'y8uT>_FiÏ G(Χ 3Z *KcˠۧH[c+\Lǂ$N! L:R*S 5 yJ0?H~!YMf[}6d83h;)>'7) 5U B.A%0E X?8Rj;x&Iw#TCcSEpml4~m%֝VƙEyDx"NE]>H=nO G5pP "e+2%װLH1Vo&`xy)&-m{+|XyYE2_T걵sw&_a, H:uΞi O% %"vMm%{(z,?{)c=1KeDeͩԠC}8MR4iTB-oѣ{95WkFݙ8wiQT& ϊd+<-۔j{+E -d)[UDIpFu=/$1Sv;Պ+hphtUmZvhF4 #SBV: 5Oe%NSg5 A"Y "\db8tו^c8=6ZAoqݥFy/Q'BԮZ-$?_c9y:4m>&;G;g@Rp uRe6. TjgѣLT#kΠ+yNmyk v:J/ J-!LO)Ϲ۵8Snad't[pG!WsZH}[><|4K&pٯDV, JUh^>ZK3R{[lɔg_SC^9pMy8kGy*>XRR+^m'xhYKϩ G}Ť]YHr`g0NGwSp$FoEp;\`/`=x. ??Iը9 ? ّ[,itL q ڻoKԪ48tSgy1LGt8xy!` I F]#v@afv'ڗ$9ȩ ӣ{6rpk}ڻ@9{[n)%lr]mjU 60&Pe˽#1o}NکBӹ|H~cwEܻ]fa:w.VNwOzqdhG $h#sB3ApENӎj=ߜ 7/Փ1[\Os)s3NWgykm`SNi%%6˭.١d$,4EN4o}ȰCHPu$TF87 sK\<5![u ; Rz:lcu!#0m'jM&>/O)3Y[a#a{k aHV ytF:h9C; حsȭY^PiPͶǸv#Qk hEPB$Ѣp& |'%* 5A'r)PDRZH$;)1p oj#u6A] ;hBzSP4E2r$I$$NBpR)$B(2u& SQ̈́I"&HI$I$I$I$LI'LI)I$I$%)$L9LRRN)P R'I1I$RI$'LI$I$$I$I)I$I&I%)$N2I)I$E$I$:JRI$Qk U\!Y *aB ,ByJ)%@-Z!jQ)nKr WI$R&I0O '쒔I&I4EJI$LI%)$LRRI(L.dIR&IH2HI$I N$H)I$I$)$I$I I$I:dI$:bI&Db3Ju !$u\'Lotji 8[LX3[^Ku+ UOV|~ügx -/c$:ZLj)T|@uIss5,Bˎ c0N\5#a-;Kx x{\Fa"wdf\=:֓e`) micxOsD&c[j<ӊI;jF }.DTZkxy$);HX9܂24k͵:7uֿ0;>և{>!'Ӡy!6jȀC=U̵M9ZmW;mgTּC XTEDK ™y2̦a%%vc[W5ѡ|ud$ګ6j>1̀Z{4e h|CO'Ddy#q%6FƖ9 ƵZ`r}U67k0[L^R&sjNsw읡0*`Ks⒗exսgƑ-J㲰1Z$=5];!G:/u~><~kS_pC$KDT`?zn S) K̈́rVRvfˈv%yh.ٽuhQUþ O$2H3B#Q1^gAIţ_抓V9i% ifA/.ON2 .Lk@gbxV>}%U;ݰ\]\`Kc@+'otpȪkEcxm-|& mbu!cu}"I䩒]X6)ͳF8id-zt(bP֏ />iً&\)ʘD,6 .r'm,gi*lA&4UW6g\i0V6vFWL$= ^J QM)䣾S4*a4Sw2٠ԧL(>4=~n[ID$!J@u* xBi5TF/d$|AㄒJS829A* %ѡLA z5+M)r9Omv0Bb;JO NM>)d`S ߊ<Dy*U:dSKu)t.I($u#☈RI$t28N9!&JdKT :$IH~!FxQRI$5QrD$I2bcU |*RI$#)(TLx&I $p! ^Z$F;';v 2tSJSGIRI$#Sv&ySBJRdQy)FJI$:_D:I‰$&1%,$ Fl[r#ARb%d\vP=hvNa ?)Jy)hTK `mBL\BtMnS |r [ B A#N%6'0 OՕu !6 -,Xg+mu`:ϧђsCHms}5N+ K"ѤFX$C;IJV5cSYfN+^!Tl76+ K Ac-=!3ՌvҎX+ wAǵ$6rky <)O!n+ďOgyfdv;R{rq=bϢ?-,.<#\c &ǽr@M`'ӱLr_U+elǥ4\?uFznkعܟV3l5V8{ZJA74t%MMF3=u@JԬf:.UUc;~?}K~̶c285Yt@Ep$=G uƗgṲf]2<*]; ʜj!-w?lBH(Mk\ݮ?8)Vw6wħpr6}a%7l6mc|+wD:]}6ƞyFA}5rN#^m}ayS5ⷃd*cJjed Ef$Cis !u,,)5js??G=:v>̤qK{;lxJY=IN١h$bIn+[?)oc_h>=A;+y }u!MnD~RӫA%-f)YfdePݗR̐}%.k?h]Qÿ+9j S+8T[c?ѱȆAqotT2fEnY6PMIiGU׻q{?J۬@qAGI/)6hԴiܡh.g%\zlmtDp^=B:)?oSq[SVF2ߏaa_X ~G(})qpȠcƈ2Y`Fll))n6FE`ЍHB,,CTprXpU]}W]Ă" վ |9G+h.nNJp$I4ӫӳӣ򿖌i9G*wgl>][5?桒\H$ dx(XCAlvQ[Ny-N\,'GBFNnV- b>jOװMo:V{\^_HZ rl'\G$k;DvBvy!JGf;j.-f5z:r ;Zlw.l}%k#uzM>R{"gq7_@T2{$aIa;*aUW>'lZkp^OY.Kw^G-OE^7^]v ?:p |w)C7IMk-Ր M}׸1[;90C#T797">;r6Cӊ=GJlӏF}gjs<ZިbQ2cOw6eV;^?Iu. --%M]NJ^ÿ֠Is`kY 6[Y"c[++ sqEorFژMz?G8Lm L!Ɛu쒒mav`5W-ʺH8FOS̩ޣg!5o\SݧdmG :d_2K]Klt*uƷ&R1ͭWXF;Vqn@i'Bfcq#$*n)hun#ojcMiYJ>jrkn U 82v42726, HqMc[\N~;׺1(X1ku }% oa4N?c˛Y)K#b[Y5 %{Y9$*;ʔm{˛[3L|;[u3=v-mu f踽2$me3v/:~x?9KH=}79-5JHn#9\4ĪM{\Xkh:MM{7WN3k(u5pq# \j{&KHp롋k q- V>nh"~qI] 1?}JiƈoZ{%n 2 Jj4o \BNí \m[[ rK+%@Z?,NH-"HKHtck䂒/.IFI>ϦGGCk]n hVK;<!p-0/ a$i {Lˀ H;xPmWe{FNvCC+q_f)q:)nw4ա[*-k G͟-kjdc{SaUP˝U,Ȉ?G"];q# 4읣 +!o #Uan.co =DYv3~KC&gj[dǾ#RG*X-'B02@y8 ?Hʳu׷%@Pm[I̸x~o~g+gx%> T0- |RSS}$Krw\=@=S:oD4}rΪk=2&Sfϭڝe&&&ڙ}#!cA׸L\mNaLe{}ZI2 QtEHp1ӛ ; qx| a *@\8枣r8 č6-o!IX_]Nmlk\lrU[ {51i ; ߡ)+Ñ1ɪ vpRoO85CHT>̢SˋIm>;k|5Ęs`F  lXh  ۮ`Jb 7K@>~jkC>$[ˆF?fw(ԝύyw0@ё]"YeDY;@P -i cAx"@7!tU'l2I:;On#K̷FΠq%:67 VT?zӵ Fe BkD=ү`{,߲jm{vՌ6$;ݔ{h?3襙^C-{#> lD"Z^> 9InJgKE{qD!ۏqe΂DDEѽc#ZumPVl>}OC}s"ɗUZl8UsaGob-;Zs#Z#m`kIǒKw$7S565ϭ >P6ciu,I- sЎJDC'VX!㷊HL\ HJ]ow4~"Qh`;,sjaU kk]&vNOJg0Y[ȖkQ- %3}ηE~6Tv  Pv{g(m5`p-=VsʕNeDZ9p,u.oY8Blk@^Nc.AExpn8i<u^LalX߽l$T8hw>3I+phi$q-k=\0֨9AlZ8S)nKJK`rVf̖NGv3kgsZuFixհ{q[#4~(XcSea,w4sGPL: 5w)q!2MR!h,c sCk(o0d#߯R6 f9)!iQȭi-'NBO~`kk -IfUJ˷ja\5ӣʼA40n1$pn3%DKѴ #܋_%5 .q e.hݡS(5j"{'m bq Y\°F[dL8ufNTescQHsԻ3s3BJh#T37q8T@3:=p>KEfq$wβ"YX։ogNI qyFz)%Z_cI #X{;wpM./ĺcRso `U%Q )ٻ_SJ,4bY?Kjjq:N#c╍Ir$" 6{&H?4AõDk-i׏W9 oIIdVkpby TDZΆ;*^xu@:r8&kL#5G0S]vbٮ:@K!!TXsw4;c~Ʃ=^ZSqXG#Uot4,Xח^+'P]6א~t4]FHG5!)Kf:BV@kkB-| մ9̞"2 [Men'}j.(K*_&4Z=B ?F {]cT$>(!nCMqZk 8aS-dC%"692.Qw;#rˎAuV1N?Nw{jըCfw[HcML ?}ńlI]k"6}+`~xNd(45 -w!x6 AO h`kuJ3캗~Zr#o [\4D NƁ(-aZ} |RSIYѭ:+)={v?IOn'OXCfx ^AuLsN# |I*>Lxc[#_Vn\ŶocZr4OcaӲAodTvs_j=NOh 6 4Cu'ISpʻ PCsohf ,ab料{OYCj;'}2UmhL|sGt۹hhSӐi skE:Շn{eS-Opb풓Kf7I(*vIF ߊ\ۀ3uLh &v[AӍݾ# yC%GJY|ۛ3"cK@ U*EPc\9ݪwt \Ms >3I!TsJ׋?k0|~uT\[1ls>,3rߧSv=_ <{ {Ya6#AAՇcN~xEwox'VvʌvBKoeO5~I)0|{ wk­QH}nnH34HÝ=۔*qN i!oHZm{2t(k=B%VKv>6}?+X%ڟ3uIцgALщ:X9a岣 h=[! , ̫qq4w^h!y['wV7ҍ^c_ޟM~`:u /Xqif:/$u{Q J߫q3h6>$I$I_aWY_aW[0Dat3ҘUYyιj,̯\ FTgI *d(ZjPAG`B+*YXke DҚTdR}jq=.2sU[+oU%v%h .rM $&Qऐ%2S<5jI+B[Td(PÔ"NJJZ4) %"T*aF5S$gSΊU@_ڳ6H-[8Hb;GMZIg7BODOPanMvPoд)lA޴hЉd:ΡSϵPpܕ1Mijp$5ys~JxW*թp঳5BhEnZ'ZJ3IV=EU!ZS')JS$TI)(iJJRI$L!0)%))I$hUBTTBPBhQޟrHY$:I)IJI$)JJRI'NSJR%,t&%,tQ%,tJRNII)IK$$钔ҒI)BhM-)I$xI6ےRI(RICr[RJ@%>0-)d<% MMRRҔ0J*I$OEJ))d'P(B+ )A:`vRܠ$$2Ut$E$(yI IJdIe")nIK$%$JRI:IA4 )dH Q)RI:dDRSJI $IJpS$I%)$II%)$I$I I$I$)I$t%))I$t$I"VuCNAEJLS!*^ )%`4'LOݎ+d \7JnWxו U`1V(T8Yeo6ZFe.y uC"Hm#{+&Blq|;q'VEMZLj\~ safASmAB9}Nhs$!U]QĊi 敌A:vAM,?S^C@ G`{ZOk-Eq R;"b_XԼUw]lHdx4HO <&Cv4{kpG;,k Ѥ)CF()|[r`Uvw7 ډ.i䝙NPccdsx\׸p77FNÇ~ߊɇK खu`T.wѧ|Zd{;\Sw&m0DQ4~zjeߔAur\Hw D8QCQ-64#Dz\=V2[]nmMkAY9T2=(J5;YO`7OqF IIz]u~g|n̟KIܲȖ7O{sZ'VƄr*hSQ㶲7%;==:Pa!Ow!{aOՇ-S6~ߣHO#-aI0󪋀D5cKI' N{Ca$$ww3dK]8# q쮳k_@?:{ݶhHpP{[ sZ <ҜΜzu`Ѯa9sTͨ7Sѩ{lau.xV~EGȶ9:,܉Cš7[&MĴXw4!m3tU1Fs^>h@kJ$58A)1B;x@?ANL|T.09DP(!3* Ԥ5:)5P:|Qk'WsV).D>As@n2w9qjXSSJ}ja/RĝJ!V0On57@Y*A K> |QDiLYNS ㇐}&5bѿGPݚ֙h?$` Qt0Vݠ w3Bmk@"?qQuL{2qƓR.yӦ` ~*dK& paJFʩa4eQ|c<--)^3 .?ISaǴ?y" ϳ0튎cשX'ՍEYf&V?;^]khD$;sd*Fp1>)$e2 }5ݨ6ʍ6CYguQa}oZ61Z]Ii_Hq.$3sX)5Ų vOVsTeu5R-.Qkҷq5\8j4nx|M]x.lm@X\{=ڇ!*zu;Ii^cQML`W)kI־H#YNõ%]sARqx褦5cRNs\4d:F6;il<,zj{l,i%^kt=ZmhL$֝E$5xƒ= e"6}pdkOy֩aZ]KuiO}78˝RŹw nKؚ^d">dg$oܢ RSjeb}NJ=k;vGe5CTE31,?IKOd=w B!%5Vk/2G;vpՇ?I=hn8P:j[[3ZQ#H;[ΐGI%9l Eme\'5ô۠W հTF6;thz6 ?M}(`ü()ms[P\q@jG+4śAH78[g h;l'sX8 ÔW|H`L𕩯>ݬ8ceu=w}|&}[# Fmp,ۼ x"~t`/uA< g㇒(8cHIM,6}Կ s =Alnjhs'Q)6{rkFO*!?I49Z4n QSM˭ִ} G^׀64O~X{Snl鹵<04ocQ'CDĨh?;;&Y$KDwBkv5>Nֺז]٭־>UG]*QZkԴk*\wh4pye΋'/}umS8GcA>) $T`U^`. DLzrrhoَGfi[?un{ډ;lob_h.cla Kl6qqn}.|76~=e"+mnCf+ ΨI=t*_6KAADmwAM ;і:]<7U~5< 5_oє1h- x^S^$ #ֆi*9xDǨ4LHSWM1堉0*vAؤ4`;jwSĺYG!*G1Ӥ}!e ^ûOe0/>:51eAO) %=}ad{Ӟp U[:X,cBL 9#FfPml- cxW)Pqb^cոβ8#u{~ ~M˙c%{ mp`KGtϵl{ʟ[ >=Aqx:lrTŢSKnr2enMFNKaOCcяIpl7mq6KN氼I鶳ikXy3e,s]@;*qhɬv]Ob;(9!M;kvD$] %$o nc!qTEԷFjd,k;i/=,g '5&4>qt'eEճVsQ[][='LMқ~*ݤ_NMqMbkT_D=l_+Z{KτL~%3[˼Qf eg]m 5Y[q#"ۓC[`4sDgak>d@%YaFԋǏ43 >?u }sbaul)6;ZCA vw6EE"\ M|;ֵqjuCSL}V*ǫ%!ݶTHvsl7C Ffl=MunA}whh:)stwrJiZn~hT3o"k=2>m|KN9Vj!8Gd U"\i"4S_1s#WG0\rKgADr1j`oga\칁k]6wM[r*ɣf+M[CK+k\/~V35[6}U{vnt#@BQ-}~acFУhS[Gj75[HFe`:NYMqm><8pYHn#<:H|Ph^*{yow4{|;O/x:0VntE}Ce6aҵߥpw4EKeOs"@⒕Knk[gfuw>!g(X\`vƠKld&tQ\AHXl /ZƇ;rEr \g1R~ v10}/[]Q4eֺL)'hMI=}E(ȜRYFs/.אoh/aDNAkY\tH{EkpANՕ[rzqH < _qxVW{_ s̔a~xDyS/NF|wJOf -n*YuvUٟ2X'kN3;CuH;?2;\7?\Hpdہ~L8JhG*UXڒSc` k6 iKJEoo2"e Gmc&r FArv8zHq9;8:%,Xj]ݪz}(nzjeV5d ~s`;$(H{\ѣ⺺CwM2ߴŃV7_֟ӈ']5F(WX}׻W%֍;*5= hE\%o Kkxm? 25Q3h|Os) N)c})i{-I忹UZ 8Z8Jd~*~$>zpv[ 'M3C]eM>B~FPt{UCvP&}>۽\ֻW(5w.bK 1sB c]>BmnkSܓ`XQ[e|K?B9Oe ^[IQf9,{!Fvh纋#lC6dK_GѝUK#o.f7pm\fo!N6Sj%l%"|RSK1#,%gimNRGMA|4i)ˈB )57{^g:*%6uj=.uR`894*U ִhG(c}G9HQ,.{5؉vN >)vR+W#NK?:Pa{Z槣3.,>bO'Q&LvLYf h活c%],Wpk-:;ĐK{պy(O$Wq86B*N+ XwO-g*w.jQ}8 }ruLcIKTlYGrjhw=ALTn;JǧSf `!” o tSzOv_T!-2.ٷʙk4i3@<%1Ń!ieӄG3gy4h:}Bf }G;qy&1h;(Z N@3eKh}5.UNC$O15Aw,-^S:C 5JJ@k\)U ʳi->zDj| !.C@V̈RG;RՀIM6WN,>![94Gz]8B/*Mu9oR9N}Nni)c`@Qq)nz| bȽļ9%u-p/:Q5{'-?N | 43R iѺ$IKfnOg\*wGmvcD7%k==BH0e3I4Ma%7Wxh !=)ƭ7oםO^t#NO)ہ%0G @VP{>5R>i,'AOea&PwiJ pJw3'$0Ymoww % ~lLaꈬ3z_IťGI;[IFL iQ[r#"[`G_c"̆ΰ<ǵ@9=کXuW/m# )scCi$;"?i H {$h+ #1ĸ%x3PY:#8~Pōw))yK5]la鏤B[ZLxcm{n΁W rG}|k IIRK> j6Pw4'+:>≊XzlI 3=8PI3R!I IKKV cF*ラa cݷuc q-K|Tվ  %wLL{7cFFV-n'N$dbn?F @4v$cړĹdDT}_>rS \>AYPKl^HZȯ;oMnwR|kkn7zq@vjm'@Sˈ93[#G)\=gV[T@Neڏ AՏR;P5 TF`ks]s@D*MtQD0aNR1T6@?Zp=`cXwWͯT2jl i 5&`htTc[ =u6*񱠰NMF-ѐur>C.p{d(vkXhFیLm*D~E*~^%-7pl>$J`s:m42} t1̩l`И> G.gyiRtVv=wY;ȴɱ[!'4nyA'A'[$s*"ݯt%"4RGklpca`he\#;Y<l|C E YCznݩ<+97d۴@o^֗]x ly6~$TZ]X0a"Ϭֈ&b%NU3\b 0G6[\ON -HBv'~U w:/71~Ugy?(?6~͊vx\qwM'Sx/v8,I$$_aWq^y??*XȌ?S'2\XxWʐ$:)>ݐ;*kKinR- Zb-eUwNP6УM$Dh.F(Q7(P\$+ؖG*7 V%)eȊ.VEӵ $ rNp(nl w%$sM0-Tvܜj!LX`4)=VSeBVDu'gfWҵvyȔU-BZXobAZ=6n T\sB%lN̎ZZCUehITKp՛NW©{'UUߢ4$vxZS¶HEQ@T"K4"Z 8.z*$$$2[0!Ry(O%QPj*n~҈% :BrP{+p %:fPL(lj6qMZ|*ԔҦ))I'NSJiI$)$J!%,IQI$I$I4$$J$(2tE8IJI$NRR$dBJ]$I$(EJI2t$JRI$)IJI$ꍚ{.UtT!6[)KI} -u^OꬬܣbF2_NJ'U%sI#hA w$xF[ 3όVFEJ#>Nl#rI()ݽVktr8rXuZ gЇ5݂G';]dteDXZf"Tiy6=;CB$aOȢ{eAm8>A<F?K_mHqKn-h f#Kԁ鹺)6ﭰ))cUw~a1x-pge]ҰlokNfosy?7)n0vÇeP}rO򠦵15P:iu/c~;v1H<&{.<;TMeg3)v1D8p;pt!3oO 6NGJ 6;4B8jw*6[Pu'dN κm>ʓ"7|Ij;$ @pt@IOUjp߸WO*8 ^}>Ao)˟GXf9ƃ5))ĩks.ȏ*Rfr{ Iofd=#%H-b cxH"cC nRSg Kh{wxзzJRMg8;jqMshY>sXBM鱌'_TUʸrp d] L2?WR氵 b?+iaH#KmRD^MvVrIvYqrbLF9 @>mmlQIo1R QڡJa1t$֛|YpJx qE44ԦhJ!D _KWxO:CxR`.ԩ]:+dS8N9*6?nr6h5r``JӒ*@$7Nԣk,S(7uRqz^] nS95 =ܚˎm:XFO)G61#6+Pkaa\I< 8Ǥuk- [i}ޑ}_w#YɸdeVA}ZW{ 3cjGW\ɘMNJԹd^H4ҮVIkvjNZd^ pbkj4Dy ka~UzlDwn;p{N=|d5u޳HEnx}[~jXTdI)S>͢A|ْA5Me&|SX2dzX+og?W7c)c"l|OneAj7]YnhZB`jThwnxD5C))ni2 O2^úvs KY@Ի՗ENt/TI -hvP!O4 _Y1;8$0\{\mOڙcZoRGrcj{tVv9R&I~ A3\e9F]N?;(EZ*k#Mi}dwҲ?9=6oC}Sݰźih=&7P  TMY%:(W 5=jNߔ[~CH;(x86vg"ci ёF5y)X 4S<ޚ{+uaMT,kdngV1eXtˎUmﱴ0 ~rz"|S3A?G˔"a:ch"=?@@JLZHp:ʺU xR55"yei,$@`Ѣ⒑ -#Z][̒&F^ֹ 3UKm#u}P=A7lg~}==`K.]٣)׼f`X'' +q)`MSk͠yH `~n͎5?ĸ~sZ(%0CcCeZ7:OH+.6Tָ{F;]b˦Mj~=685IF؎vFƂ%42U_  6UY!擻Z=Fx>OUFZcpoOna<{xCps i|E1))Xfw1V]QX^=ԭm"kF <^ݭk*O8ci[S644x;ʞZ]R,l5<- Jpa(فu~Ek@ aUC_]M"NOP#QK74D714hSTY]mp7QEm8t.r㰀]#Vk{!Z9D4?NR+s%l{zӉYMv>Գ]\ f攘`7R*Oòv60Z5; 7Tѽ8&"7~|%5pZӵm{YֳkLc53{^Ɯih 2C]?D 0\76Bm6ǺGuam`>`6cúvh-=,O[%+.]ډoDnQ20ZͰLc8'w?,U0'R-93$,')wBq[j`;{y[ampP6۔C@5T[3rn{/g KmHyM^# uRt5v?I%1c_L}&Q˶kW~W70X2]2_ĚȘO4-pm?Edokwm5GhQ\,`:G&n>YwENS^$N9ŭiǩ?$c ɋSfEst;]%n@]q!lpka>N& *,av)ˡ?`|ҪwB* hs-ni 6aѿjR}3ѬpvQd,| `I\^MU\fy UV9g*8n<ʋT}9vQ:8,4YcL '(yǦ\S~? U>ґN9%\ kGuϑQp <"{8[ķs;,LW:-׸ndȎ ïv8rC9۲㼻 ]2Yi$8kP}3_ctaS_Ƹ8>N}-ms\[Xof\`IwpKe)SْUa4}U*0c*k`'ʵMu O'zl,ڳVXd{trXD'd*{ [⒜uDIƪ mv40Y 9Ed?j{ih(PK{% 9* P[S*{vrygF7-pmsLn)}1̇AJ8;5@Wm˻2Z KcMC@! R]4>ԆY6K w鹮c-H?)VGw(e宙sR4N OdSXqIMʯuf+{wTuEIB1d{s[oXư=:RepIl>F5))fKV5Et;(wSK+imHGI.6}Mī.n..S1Y}Ѹ ;;3 )>5"nO{?(x=_t|w~~xQ\aDl{̡McGSU{=m{7o'}Osh%v @՟scO] .ni=)i$lBwY8Ri6a/L}Kv܁m-Ȗ<"h{m!ڀ4f-0 U~U +2+iic>:mH!{ʯur֙$=S.fFCC.Oi'.Zs S4n5Eud6duoyEgRSXuA, ,Fr v~'y!8CGQE^ݤh$q28;Dz!X0$CIn&8V46ŹPKkim }嵴h~_HE 8RI>+20"Cs1vc^?zhYdl^ih94Lnpsck(68N $}1}!SJvS.j]Ef6oelk(1\?99w]i(h|'x` "JF,k o*a*Xzuߢ [M~kAFò@OBp5+^dj%6w=faxjY ڛ>˿2?GOd-e5Gccln焔9mPtws" C sȯM(Ĭ:=쏤HB⡱ׅ1`:0h9CvםA⒚m,j8:^Km~Zn+Ûnw?q*D֟u4S\@PR){IaSkEmZOLK/$ϴ=+=w樍AXq;~DƄRSa,mǗџ,9/q -JS2>B꼷y%VuSá)5kyk u=~t{ ed׺h@Vm]SZxhڭz7^DHsU\4Rp<;c&S3;";%Bku)* }!:kA|yC~52[&?yIM ռ~w> )K5LC~=/Yd4l cg4]R)1DxR gJ\ C1s%/e$}>O" [\[˴eXY?$š?Siq2wxy'`)jJJ/ur;6[} Fܚ+Y9sL[]$;D5`#|jzm ts♬`> }#plI*[}r^8Rf07vg֍K]}JZj7Gtk`HU|LOPYA:HLp]\|d8IòdB~ | I)[ B,tQt<n &j-HhǒBG ӡ$`tU,xtOf' yU]cHu`#Oy\Gu*-+364;8n$ͭ9l'c2* Z@OVcq{iax >ÃڃIX4A>jF'GKkaPS1q{&FΊR덀X5N8F|Jc?|^ي_glaߕYOJ591zM]8u8}k Wzm]qns٘ l(\I$I$_aWX-yv/w)?d[?Jb}Uq]w4כkGb?#Wj/5i-K !r[DoR*R/I#TnKr\!\NB^@4#M)pq:Csu锽2ѷ%)pqW!Q]ʏթ %]u?i4\z U HK+_qBłҪz%/DRBEŇ<9V1Z6K+.jAY9 DI&r2*:.P;!DK'. &hҲ%KoKLƂVD#-pԩ}1JǴ0zN(ABsL<e>?E% ǶqۊPx>?'oP:DK~4i_1o؋tB{LiH?jO !2 g`inI:3ˀ?0Idd^,p`5qBD-XYV2pԙYWIV!)&[]NY N{[ܢ-rLSVa%UmGB}ɽ3Sߴ@M)머RJxI Tvo>)ˠg(^IRDdKCu8Pe]ښꙭk w,gr>9:wR{ hfxp.ײ;k/ԩCk|@5$jyVd'?nF\8A0d|kI2@qN!a4{ @(96$XG4}80 jmGDt3oa%MWH8dsԔ< }ΞbO@'ҥPI V)%9:p hoe P* j  G8Cp'̂tН0ħ,# x;Z)$R&bq{8-RRJ{A d#3AcĎRD w4GOSΩS$I3u 3TI$BcsQ(J}G%6iQ-9I*I$T[Ģ(+$2xM irI'cFmhEf**"TH줘Htk#Ӫ9OʈO"۴:96(M$*'MT)^uB-Զ<.9EerY!DxwM/VT,B=AhsĵBaaia@"Z2^d0|ɏV^C9OwS0\ 8ͼw=}[]g` _>x+'!lf@WdXHwx:9,iMIޟsj}هx%8oŞˡB׍;Qs["?t򚦣n3:tsubleen:it9[ΤK]D}USpkěaMQ&lk;vl@n6$cmwR *Y9/ȥ5T~?I9|8'%ߺڨ\8M¹Պk.%'+:mTd-J`gU@:nVedOfncjkl0*0 k{P5Dl8Q{KtwRSfKs/Xяj/sspnJe-s"wMvC2nAc6O`w%.vN-7{+y9{ ͚=亷}ioTqUqԋ#kGTQ 9 RYX3G*'8>W@,@Y?5el%۵lI}C}-{I =@ G VxmO%ʃs2?6z0 _C\[۟R2cj kQM7kk"4>wjv\ 0\GÅF ~()oߛ`+ve, Uzv0[V1Ǭpy? (TK{'˚R <Sc3 M587hmvG͞UVW-HjPo.Ե~v.3si[,s{6ZRɾZǹ~ IsTk]ҁˏ&,A ,aD>e4\ =}MPܤۅ s}'c{Dբk7[12" j­Wmp?JnS=6\H oen%ǺYVx> h} @覱IpxSkltO%tR+m#F4չĻډp"bվڬ XcywbxЖed52>>*/~|9Jq5IMl&86?Het1~?QsRv \6I`G{-c7*DDvS;- )6)"G"gsYnEƒ8c6X5ene< ׎ƑK-a' uy k k'T7SH9NTmQ:]*0]Yc^:vUǰ[cklxP. {"5܂<8n(41kwbcgp'Q03,~Es/Wl 8gqou}>Z7A nONtI>#2 %9/].Apo§ax%ѡksZl6&׹y B8,Rm$?MIĹSv<Jm5ZX/$iWfKE#'IuX_C,q#iqu&aޝ3tJ-@CNM]-8\p{eKӱpcZy. 77-=9>V}Vjǧ}Io,'ioGӓ @o|{ .lZQ-iL͕UZt54]`=sna;wI퓺~IS%؎)(^zwa^> U,\i][X"p|nwS5X#ݺyYYʁa]$II.x {=Opƒk 4}a<2?#ڊC5'uu {vH7{D5U%Զ 4 nkdod{ o3뽇Q%xwҞECN`@!&hƝVz[QHn~705յk`uLBp|@e\ʫqyr=H'Gtǵ6pɭь4 #OP"aĻm{#Cw-l,%nsFAL<\bûx2)M%6i:KlL 8ȩ1ғ=؀rq\wn|hL鵧`5yqORtN QuPèF͗OyHhJԡUL. ]en3Ga3*kiʹ~6 `Z6W!͝J#@n!}hҥ}u-ս&1@;HĀv%Eev*PIMYm.{EqqUu9 3?yNn-_w1{a:6Ai5[ i*a>Ug^eAMu>ZnA$6F%%dUs[GهO(2_oÇ(S}pT@ݨ ancJl_4@LA~>&k)l \=PxAssO}C5cC74Q?Qi$6 ~A;'#;$w8-:0WZjp^*_P\4x*Xw?V:ophlLCdǔ{N9e^}Gg8%ET]n># {[dl)?rw8LNj5($湺䂞0+ѣ%#7t V4[i/&s+lodnɗZFE[%w!$ȼ۠Ck )m_**Ü_nֵ~p6=Chfc(\[GdC'DH#-6 II*üu?Q2moX-x P%ͲZ#g: ;Fo؜?DʈK[%ܧ#۵y,sTMCP'iJQ_61bAۭ[ }ofC͖h a*h7wJZL: Jx''%LivKvCC6i7+՗7 R>CfZ\AuIB[ <cC֞TΌ[:>=/sjְuo5N`\=O#t#R5! 4< Q:S] *-4\?q\6psGmAe h=qB788 TEOe': a|jOojKFk?zF96]ަ0pkD{ZCIa q?oK147S1 Tރ1 $<R6\l#9*rAsƁM?}&>4 G:eF.{:uIdkhihװDft!#=Z{s?]-[saXTݢO.@ƷnAhF |*{D;`G ń$vYK_YaQ0]v'W8BV)bP*gSsI=ekph@`>++9fD 6# &ˋYJ5*'D=ID!6ٔVkKyxh1 )5H u)Ɗd1$8N%kFRiG'Wqvi:;@& D0WOdZ2}(u:)UVaGPb4Co> ?BGeQ| mۦQtZЅMnsC]%OB n&$xB#Q#*K-U*^ NN 60㩟Z $<>(`p׏$= *mYkFC-cu互 ~Ы>owۍ:6'9!I=@,0 丈:$?"h6("m'kZ~)K\5BT0z'c d:T !:&aH0I#IK_^SZ ]$hhG+8{ UfKXLoIrAr'TYK=XyUc?sA_2TÜ9EIcTqԂ'AcdR9?KrjwtA>aH$ղ3[P[/7v3׺XEc*l{L>Mo^I4 t> )Vq= V1CwW@ju%==6 76`ti1k0TA/v" .uvL{i{%qX1km-?S瓨ϽIUT)|QS{+]V KC+-:DKS ϩ?G86$7w%9{IHȶw?w74~qoJ4΁_B k_p8St`€sJl_n<IVa,8UksYsvdQ5X#b^gN JRQA%޸M"ƄvUpX%4i',@egQjDm{{$(Wk& xR gewo6Z4Ǧ=l+~Z}UScdK~['1%#9{v3!m`\&WpjÜpma˧`N,NeIR:uٔSf@$XZR?՜6AAJAѷrF؈'0> 'hy{"a)=d[;7<ӵif>c z1꼈Qszy-xOw0BE{ǒJgUh~DQ{L},vC%;IM/GP5iks y!t[ߣ Yu`Acx;.!ayOlI, Ӵ|q~T='$n`;2Y=@yr;}' 5V9!'PHTKPN.æ&IH~=gwHǛv΃kpnPXoXT{A2yRe.+.,=ASsNP'&ۭMmʅ՜ѻ}GJ8U3OӣTD):ͤȔ~x>}>(#DS.k7Ihwz>Jkq Β'F{'uqAA YiI Fs%SRpDn6Aow'U3kw $iD'V5ѤOX )-cUu5ĸs۸] ւC9\E|qF?57> 0 Q Z '%rM tCqa{"s\[S~#\w- QcK O1,=3K JޕD֎4ֹ2,5Jq5m l$AOk5y䒚xun aif=!̍ICJX?|5́8Lֶ X`l5mV lLJym//:<r@?8t;{u 64 fIHync?(ߚ=ϸL_ 쩶i ϦSy&H;dBf$ pNƝIKUϦG;0d+˃ iq:uy74~p a,;c}0xJaMi<^g3ݨpΝl{"f=g7?Od'5A^}F[:;Cs g_<U?&OJ591zMU=.H53O Smߪ'w>'\I$^ꤒK_aW5!y/0f?Hc?)U}1iݐQ/QU8?e)}k}/kKU}TTUA*-_鷪ުoUSde+W/+^^%%j/I}jIz רUDDNWٓetgz[oQ/Q+U9gK?%gMW9e δcM*oQK1ǂ-!խoU}DV7ɍ OUoUTT}8i}/;ޫzz)8OutάoKz%$8c::Az[Q/QC@P zޫzZ>'„gGޛzITT>J砤(GN^uZ.@S4Qe%&bJBaT^H%FbJkDkAM›z 75d`1>'T79ACsC6#Z"{^$j01P*IRI$R&IFO $LdNI$&N%)$I:d)I$tN:d$I%I$'($铩&N%,$N' )ILTؠTڒ)$SXbIJ 'LI&N IRI%)L:JRI$II)I$tJI)I$I&NI$I$$I$JRI$dIJI$I$RNN$R$I$ RINdR$t$I$I$LHnDPS iEz5n;4Te`P9m5qٶPa5 QՖu2s\AӲ{4=D`Cl q+S8kƻ}99䡶b=qB*90yZ^-q'=A~IPK{71w-ō@ 4o sV5pcqOQ,Ŵ<ՑkED,0N`tp$Ooc_ʕh8c:X\A\?y.u%h06^=RV a5xh:;Z -aԍe!OJvC>#K} ԲrV{KR]9 82`(eW&k"Lk"yP]!g;cN#B<Sw+%̨Ic&CX &lD 2Y;{}lUS.wUC7;!hty[R^eM:7"qnug 79C\M؍GޡeC\'QXNAMP-Xm<PK- Ugy<6p:*ik{sç@w Ł3uw>Im-M"g 8ogz;}=[ףjw+?-ƞK.'Ek)ܩp .PqZ\6g BhND&cK;(.3ĩ 4SN0pg(L)7O@oܧRJBڞZO d΁ qNl"⣺u=aL+D`r4z!||O*@@XD.4 $)dn>@`>ڻB a:OpKnPq/:} IBkKOSӀѯnn?$*Y e -*aӡ *Vr\ܨɶ`)m[)&LI'U)D'A(ΈCR>f7xjuLSVu>ЀF,4LT"TBvB- nv(EII)P1;[ܣ6t(07RIDa Ec)ۈhyr^ 8eC#b!A׵LDŽ( OHKt&[50Rϊ@ F7OaE-"4I tL)$B I$L^&rHRI$f=|$$RIaPrE L%&뢋Lۻ~EJI$iN1)N$RI$tiC(.$E0=rp"Ԡ$H5L $䢥I1QuDiϟElUˈc|*b|Z증R䃥g[w<Վ @oޘ_c4Ȓ'm.}AԑD4?κ{cu$?!ӔI;Fӿ;$HQ]'I02:Sl 'L$pG|RiRٻ觡I$aCPRSN)t.^| ӫPkСZO#UVҟ9R2O B1wu  cw n )x6BLh5 Dn•~?{Ô6%^};B0<L9Ӻ#}C<' .R׺s\vMJkpSH@ GDg7 SLWTQNLYӅFc5O¦i:* xm^|:mninH!oȷe8[IE>JV0 U;cLP$-F>(ta澖;PПqZFּ5nU@p DxPmՒ < {tscp-qn@3~2nm2}ǖx8WhsP莵x!Y]zhISKAo٘VDB 1k2yV({c|Q H\AwjYj $Wc$&}897?6k\ n`Y`25rVe iEOi2~3T[KC14Z>IHMV0Bf|Rߎ6mޣk4T,o#h koUk%ǒ ,ʜKl\$KLR!kicAkBØu@b=eG!܏ꧭ4{*M-- #)6[ 'w~V0n/ߴIM{KHg2UBE,;Q1̣+2QG>[Z|xN.kZSn>Al䴶K]"W]C >Zt}o?:Gs'6ԄY.ӐVs;PSZ`5cQZן0{<~!dA$ K3gvÿ}{L}aq.q?D>4k r|os8{U,848\i oi7 q/uETf^{mItZͧq/Z!;*aՐ5p`6RsOR%=y^DP{\aT9i#k@5Bmo ‰clv7ԒA{?E6d ywb01a '%lEE,Krklz%k}aeMe;_^t o:GEM1 t\QluTen{6s)m-oh;g5V}A֐-p m'E!ù@}ni;>! `X?K%V:YYRRP.ջRЯc*-5jQm!ld{|zZIĨO;vQ{C\*t W%AOJ*II4PƺI<oh% 0XwyS?Dx$#$Ƕƶm5?jf;k}۪Zd Z֖m$Z61NL '#3#t5{ű4_kC\iVV[[D:'C8M55`j׸$V[%vdxn^Hx,YlEB'm'N b$L~4)<ot+v6R)Z 6ZKFMIi졍cI~5sSA6?SΉ9(c Qjj4j} $5(?hk熙YYe{@^+Z,$AxS!:-#RQEGHpʫL˴X))#+Ǩ;1vnP]AZQO׾H%SdtMm͝մ['` !s\Kk o#PQSVUk>-qaRð˅U1J >v8W׹ H;lvݲOlz㢐cq)vQs_V%^W6ggm ]l)kiDŽ:SۚAR-`) .k96m;t m,i2ر* ,- {!h> D=㺓Gò "88wYkc 4p@|[;6-ދ.<)T|8xwQmg&eB˛kfL08m.Ksy1NF\"L݈}KeIv)圃>ke$ f,5BeMsDyh & 䖝p91i ;Oo?Ma6]-<@qhR2M3oX9ap=%,C$ +`{c6i6Wa0(%y8˫pߣ[^[ #:3jha`x GjW1ksAG#Ѫ`h{3#g#SOe]@H =XhaAxA G'!5G4Zmß_wFp0'FF1"OYyZX򐪸99 MKe /{}È(偳gݬ.=SaǟDOwv1k)ȩ?Vs2fPA7ӭ?),pq{}\~s u;<*eup(V%g jd]cB7Q1 Թ3KLwdGkIqWs%2&Ou#=ʽd3N0C'`Y>>H#LjvKknDwNy&v6ߝ:i}nIIe/5b87rء}MưՋauÇdJ\_&-?}TȨӂ AYz{iB0ohN溷rxN矤R"15Vu>eD:_^^;_?Huc7.ѻWI3Ǻw]ߣ2$k>" i;dZ~:*/sgV Zl/Pm`S}l 4y#_IMb8Zkv p<*݄_[Q}n/RQ+IJywa?\nt R{'WicKAFRSkfc9Gzns!și&ũjp*;2kc{xcZ IOQ!xk -`:--2mh9->ţH\ղ 5 ^Z'R\, ctvE@4Οkr+Q;@N4@GORL^=O8I}6sFr|fb@q ,3έIGn DAwE--N3@qt?ͫ7>`69*xԾA|?F]5̿◫{) 45M2`y u|ƆS|[k5p q[H :CZ>7h~v07hZe3 tȽ/p19MvUl9ۼ|u8q&;#W8 FLRUq ++(7i _co\Fyef01*ZϷ`F7\\.VF菒%'ǕTF|̈U0nUm읍D8N`(HæGt*oQZvI6?;'3U&3>V-djWqtՎI~IfG_v(/`kEKZ-ֽS "Uga¨YFCXwr\!<ׄH1ϒY:5Iqk,P{4fi`=lsKdmᄰ4?8%P1!uj>}:@<Lh>d}'Ӹɛwn?HΜ5zl8ww) 7W N+bmŞ&ğ:7kNlEIJ>Uq_L$<j}><0G6Ǟn ) Dië|Rm~򂚹%΄KZbcrV}f->ir(Zzfk{ʏ= VMM{i >#)D@6fxrֆjOx<&V]3 {"}b<56>-ޘC)D{=Qci"q?(ÔGyDD+:Cz:%k0ܪ酵DX@u{4/ME¿Jx` 0 Xꆘw=6$?9& )F+xs);˽o|=)*f;7FNy& 9`.򒚵K\AF^ ߓalYkn<{&,ѾHxoF}u )%cu[Cv=.N t@ǶHp঩`1 R :%u<:x ? N.=:!P4лUVNia/3=$$I]GEs))isX>%M5vr{-ǝ |UsMѱF(s\88*-"N>I)Z3(4Rd="ԝTZi z8wTEvr RB<4YHFБ=x=*T'-x1? ٙVbMmY>=h CwysZ% VC9Q[;@ׄT.ޫ6e,qm *)eCFcs7G*bjkT_lƸ; f}5( ͻ+awaL2$4܁mNkE-s>NZIO2e@J/s㸶u)ۜ p.8@ŭ2AO%k G|Q^*-5m~I6tTK`iiRZ\NB:O!]XZ DiD<(-9n-mu}GI]#W]gchLFv8>Ƈct%?/=-ʽlo}zX?*݇jsb%{.]ml}ۙ^&apN>>KI$k$_aWq^}??*wn/Hc?)UɵjBz[ M*}6M鷨Jmȩ-އ4^^0j}ޅ)JICmMނJRzIzh%zrJA,$%!%( D9M))/I_Q/Q RKД#zz2䒇 z(ЖoQ/Ur[RI/IoU71rHA8j7U'ܒIzHSmF6% M%!Aj}F E%jqZ6QZQ}KCU!s!I+Fu?Q1zژp1lQ6!Q.A8 fQ FQSTICs"S !Q 'I2pI $I'I%.I&I$RI$$%)$QN:J]2tɊe%2t RI$N:IӦI%,I$TʂJRtӄI%)$H'I :dڡM()1NXlB )I0N$RI$I$I1HIJI$S))I$dI%)$I)`$'%2JY$I2t)I$$'IJI$'LJRI$$$t$I'I0O )II$I:dI$TIE0II$Ғ:dTRRNdA I$HI$II*I$I$BI$I$I:bHI$I$JRI$I$I$I$$I$$I$I%.d)TA8%)32nZG$+,VK|0vkPHQKX μ2= [Y+cn6Eί(AAp )%Gt7ݯAK xkjY Bku|9a5'6c't!3xX"4[J(VŮ`wv[' )9`LwQGH4b ax$Te5i'n7rYq46 XnKu`[sp≣7 |6tդ;AnS\M@~AӪ'p}hOerx {CދM=ŖK[쥼-;H`<ױ4yR/a;8yRCeF݋/k\9.ik|J{B(cMHE nP o5=E ot'QjuS`-q'5䣲׊=WiluiK,g]Ej?r}[%5sTǷ@fwII2Ơ4#J ǻkYa&05R BUųsd^@?76uh;j Gp!H<)/?3o5JȠMHpU3S(> ͏sZѺx?I&͇y8{9 X3IL۬v\ƀԮn%!;JX8Irl:~5'W7]G~mr02m XDȬ0fܶVHƈet 2ș. =ڋΪ`\i):ͨ˜ڄPsp^LǝsqZO):8.9(w0%p'J#`r\\T:U^>e4LE<=O\bJ>eKl'> Ȃ"5FgvQ`.ɜ`N3&OM!g&`t#C\N6)T$ldjy쫾f$UNkD@^$ )O |T(;)4x(%j<+/ SJ0)CeEAV= $~eJଶ?.\O0%?ثU%aS74o=7)Ykt~`ɫ];\'ȣAT Ā'd k?]c7ju_T:<&Kyh!}-.Jŕn$ϋ[?Ѻқ^ZKfwqs\2ߦs al nw'gк?,VMߣK,s74HYv2kYkK\4=!l`~pQ&{*z-{]Wenmoڂn}O{ݹC~s.HBwom$ F*r^I -&ӺiЧ'C 0HҊ'AQݦ=T M*RtN 0:IOr SAB'LQ%4n 6$%=&Ay+R'Im<6Jp!$)$F.<RLL&ceot8sTqqu}:HѣiED=pTb<k_~>{c :Ap;LK'$6pxJX5/N±t7`Q\|ZqXSC[]=~ݑYn3 :AwߤC}!e81N;ǝҜm,olީ.,/M?wo\W_hi=W˙õ܃\?y` Nie,?[ _kew=k+ qm-{ dyQ9w[v#SβӵyfkU4nտ`G8F}قƈy\կ53!8ݛrѮf<,{3(-Z9 `Tv"H*-hJ'M(G*bo J;4b]yNBP>#N͡Baĕ<6kR€$hTɚcCSކѝxDxQ"~)! n;L,l8(C$ S|?Dp➽ &.]7 &vUL~pQ^p 8r;ƩF2Vq:fNа9hՐU'p/5cݼٰpUmv#2(eL`}Q{j5vf8_y?HR>Utn?r 7.p,hd дlA7+4=  \4-Xy1%{.Zyw,.V_朰n8 9B +8UHQ$[㢋z`gBvKqG|B 0\0$nj-mu˜d4muNĪ{7)h7y=k xTnoIN,/iiĝj sm.mzVf[mq'B?!_h8\, Mp$vw9pr>OJ̐Zk,cI/`:Op"o][SSy1kBW ÛHFԫGu.! )]>׽: xޓEd cr08mZR,emu'R$0ARcH0S|!E؄Ӎyo[pCڬaF֧>2}~%8W:'k iՏmCtǨmst h;"C~֗oG 8(8?tDA;f x[U%ދ3>m>Y#[򿒖mnp-Ռ-Ct?IL{GGp6F5y? [IO jDqyu,Kh#ŵ5?I2A 4O!HhAu5;$b=w;]G)qctn5-o:`bE$p5>h]!}kF4gN)8?ϏOnV2DϽ39TZ~r+m!Ddi?I<<sH #Q5šʈp5%2ͭdm}C%Vjh#ձ]Tsa|\]`Iհ5SaxR -p(}sD{_ܥl$<9H2Ay RfsmIly!#ozk r@a>ݣC@oUSkEL p2u sq-3u}cM~SaG%UǏMv&]YyS}Qs[!%7ݍ5̱5>@J0ZXYU$Ѩw5ZZ溶X,#!F Ip?"ߡoM[X^*l̤Vt[_=nC}77 ;~r 1r̶`:mSY_fljJ[Ì(VvDlpXmra>5䔀UI5 EAƖ8]fͻ~̋=jtr܀Ӵ T\_;c?^ 4)Cۍ> )rcYFf 93VTdZȠ]ce ުP 9(Ç-ha|:x)߱kHIMc8Y`n8;kfc0!{'hν PK[es'vޣKC5A9'5Փ{ o!F  ?"ܦ45?S`ʝ^KXiING*ncێݧBYw9 jH#9 ;&5;!5չCRWC;+PR\kl\4*g.VQ6Z5ck?mҞX$yxC|{%jlhum袺?Vt 2Π;g&kmnCAsXpy NѼ!q% S+,ʨ &9QF=Xծ'yewqvU`0 j o(-)f9BMyF nu^5%7-bICV+"kegq'V*,{TKNrV,TwYe֚=P>̋ZY1L@?M1X.{2#CvNA/&Ah;At7:9m$ io|BEki c4ոp{ dRSh52$>9ʴ,65yLU06ci+^e)qQKݝuh$JV-졞DqGO)XcU5̕ q ʹͫsʷcZPuqЅ" % s~$ 6Ne3:RY2_c;FtXkXrjkOYc{lXD>ZQoۯ ~ 0;Ͳj'V77IqqȰz`g署tU\A.ID@?^Z@+#ilqQRs ȏGC,T,7{G-ec.D̺ˬFZ>ԍ TniB=W1Mit4pmL/s)&Z%Cj_5зAO-TDmus |;,spkćVt)OchR\ۻ p'iqudV֚r M[In@5ru1AXV>clpL%~(@ƨ>{@oRn `EL2pȭ1͉M{W37kHg,slVay4O-iN8J\TY%u$2km5 }Yc]KC,??PΊuko*~GeS Meku$[YP@Dn[@mm{ wؖ'R-s[QTÉ=T )kLLhK-= -EkA OcARR`c"gOsU*;N%\TNnYAyK}Ĵ?; TkeK`AM\:Kl"\noȻf@1ߘ'kOTp?v%Y6> JIR!{&&4x)CYqqhL ;yzuWMnko-IoOrFGtcmQ5gבaw_jך\=pX?1-sC=]GH5!xE-;Tqvַn* #bhqi!԰ڣAVHձ,ƬV,V\6#  ׿֓rʲ^p[{CMN6L)$8Ʈ﩯wn0ԓpghKF66O(XT{)0>k\|-FC7o{O$ HeL']BWm );) cG=(Un[MLxemZ }\4jcS{GBkw{> [$wSG))33󿲯z["h?:˭ cx:yV6Ѷ8B!r{&XK|э?G@AINGHwbn5 LmŜ7x(ͮHs5'Z\RwXԐe4Li!=&!k߄NJrF X ~J.*/?>4 .0tN J58Eն7 y$tJo' r;wH45 :]Ɖ!77w4hG!流~7hCPF;ǒN{u:8qVEoq!QtB3 #^)6@S;̀ >ԬXby5`.l?y ׿8OdVtB4:8rO0Tܪ͎nZ4?V}sDpةӄ@hM̃$'s?g)y ]iFI DmALq]X~r3-Ёa"eT;`d;(cO"Au]╥αc=V 䩱ί7 vZm*F~F$@jN$;Xw/i&aZ=?! zD\[LM١C}@ݑZ6j$kcv5Uq 擠jNKO]PbU\1ARM{6CcbfT֙%.hu+13B-&6l1yYZj CC\| ĐgXv*D!ϢVG5;\sX쨂Z^loa% 3!:t;C'<̾!8Ը(Ģxɨon^;C?@ 40V^1) -LqDg==AZ)Wlm8j=ٽ`ۯFkՑP"9ԝGymj ".*`x+ew%M)5J skqji~ p> Zƚyoȑ⊓dcj۔݌)sCkCGU-ʻx xi=یntiYJΝJz̅Y٪FوIRE lAkMTmQsqSnsC'ivP5%Й 2A3)2wl%HS֖]B YǠ[45S͕yv*n.۷ t8<H*j2St藺, ]6}zo8Hxrcꭢ䩶q$H-H>F-kk{][g5SfQZև=WC0A1f;1a?;;[9΂^ ;DzX[I|xIJuS^ ;R}Ͷu^~K}'4#Mҁm[k[7aE 1 " r֍}$AY#sl.ޠJmyH(F<5@7Hf D-<Ærm"A'>t`9?VE=3n;Z^5#U/ohD 3(1O)}-0uU!FʶOЩk]ѕtdY #R}IS!AxDkad'_ "Ԏ k-PݘSs_~oX upFǁ>7轡<aY>*ldY{%}I)mC;LiʕOOk}Ǘ K)~[6!Lj?K~ ͬթ$0⒛!lO?Qkhvѣ @󓜦Y qQ2-knU\p& )k#]OqrYwn?ߢ5 LHwX ;$Cl >(:}ASbj;]zI{FMVgܣUty"X ,l2PRL6 3>kkZ1ųn8_=_ ^bvuq$N6w|)&1IQR;/+kC#VǾT+eam s] um5]?D?2ݳUl==#=VS%1YG2ZP7ЬZ3%ht 'э6U1 tjbtih~CCJSÛg8D;r[Ml uNa@ ##O ZLg)'1'icdBWbT@ P߰Yv6yU^Z;V 6APzYI;+#SlcuiDhR-$\TSr#@HLR&DϘgѿz  ?PZWhℏ 6{U_¦PiZ2@_R&;m~7*+8>ym+;h ;{ᾣWXZxտ WHW\wnPL${|BOȮKא [,oT[UA! Y.Dhis[ZLJh aGu-Gn OtwRXw:Z-oF;'\C?U\L 䝃#@?Ͷk\v~+cH3s]BwWUfWr c/6ٯpisH'Pл V)$"ZW$P[A:V|T TFI:B'ܒI)A&T Ж?4ILDnTID29$IL9NPg:$&N;FIT酫XsjY@EW6[ ĐI<-6dwX[Dwk?۪WZ(o:IyZyq&8 68dvԪ,DJNʉiAvmHtC8MYK13Zy+V:/t\îpZUu\v&4*L5CMuyCkkUW' aw=P hoLٲb oex#W`"X.LYae8Jmڎ}Zx(/jϣ(Z~Uh@SaAtʸ5~ J[6g9 sY8EӨuD;3l}ߺS}iQiP{F漶 '"V> 5f4=ȹvk;U h MHv?&-♯k}G89 x0y3%"`{,`xkOS~ot0ezxrTZE{'|PwSխw1ֻƦП)[I<;S60p,=ee6xT9֎Ф4Ft-B]WEuUFY+7!Tk[h9?WW&P3i?)=@vh Գf 8yc;Eچ@w܊œShkZ}^K ✹ՀjִӴx<=TC.M dfck7$+k p#ڢ,ߦ۝LqXhR{ƢlLC1rcF]U*(ݵخH0O@[ʵgZncO:j %=vf b}F k$nUe&mYX$L![WĐFV=mP.5^Fs9ύP~Cri:Vv> jV֝]g:w oAqEcLK]-sa-o8֞Bcae3f?Ukj-Àa21_kFAtʹ !LCl)XDCL<& ۺ)EN[-kN;^@IUN+l,W&?+Ubk/ǬJoq~c9U Gla:'OAI f^Z?Ox{8췎=nXsx},[+`\֖ǃIʮӵۚ?Ke;C΃Ya% ťuhkefV8}$ cbleߙ;vi@հY@8mٻAn@'48^Evj;DSi-{݊;?Raw٬uU'iFym- 2;?A+Y a56< lDD 9ET }SGc_F3^E_p}ܦd>FLy`LO))m+l̝v95TV=w3]j[Kms}7VVO>I7 8:cN٪n3AIMlzs}?YK c'۴56C&s[cqٰ/vkwIC"Q9^,~N,ii;9'A))}9 -;Hs:@ 6}, sʍ}5!)H0551H=(c@K?BYu[6?N9Pw,ޢZQwvRKLl Mpg^Q h;\pgk'R<\jߞ vX`0ܬz^:_TknOYHb%)Áxv6ac%0=Uǣ[! bf L5j=d I?:h<ѯWc \Z@x(Ϭ<wy+kH/@҈S:q)><85s[Sm9qЪc;†1o?V1N(sqZ+%FP7ccH>:d!i'n㹣h?tjeIǰY: }LчE{z2wlQ6jijH^v6nn;1C\iԋ,+Or|TΣ6xjpۂfquVXi }Nmhfm@t1 !^.?wi:\ Omw\8G-{kL3K@ Ҵٸ+ ҡN`d:ʜIYENo2cl9K{]Táռ`*L^ڪ >([ wJu}wA?]867Z/kٔ GWٌrX[*?;`qv3,}@YB#Z|nqȄb>T̀}'wlNh8Flim4v~jMmsmxI4?HQAeG;L\FoYjJD;zYc.hāk/m: mESm->o (mn:JU#]#8tc,ɪ,k pb/@˚ZA}"ScC[?cm!ڻ(]:襸[Sm Ҩ$)-6eZ0U8!#I@v5y^ ;CxR_=L֐FH>dx %@VG`XH`ص%#v>FHk),NTxmasa4{ñH:K%1\=H5eۉD<@0 p'`$IIjŨ5zۦ=U-㸽=mıՓȳ{\DNԜh[sY&Gwx"=&6Ž@7TsCnqYΟRے{Z4? ;Տ5jc׹}a2rncd4I)4ILo[eniJue;p ~K`!&5Aqx::U^E[ɯ|wNַ^ 8ItIN_N8mFߦ<^Qf}5-gΏNcm{_dT[>Fnqk3؎蛋%<*wēؤ}wݐSo Ml8Y O?a?H L}McgsBcӬS{Y<p?ǹn].n&2OW7$h[>U;=<2ڜ̾u[QnRF ^#Z1{P70yh6X[X,;BCw'IM:uzyPF?Xچ#aoUUĹؠ闝IT_Cl737^ @)kkQ%}JIV< J`_f6dHOkvA,p(Oꏢp* 9|}& VwRhIv9n$\ B*B-{mȆ_~Qzgۈ8!YX6lK?vzz{X 6kFS;Y:)Tݧx NܞㄜL.)X2KDvv(yVzsbu;*co Zbq nɇ l㳌c蠦P\.|Rp, 6,:+sgkyzC:)|\i;6l&v4 CkKxZ2-k't4Q>OiEzuBBc`7O-=Haӈ3NC,&yA7jV$}.MReSMqδEah38A.{;Fm|q$]\EPcŀoڱ/'Oӳ U Lv(ߣ#~)ݧ!ہFm}}C!ae)bcj?9&d06kQ4to{{'{CILCvY$ ʠ-d:D%>cIؠb`q> +*۩?6BwRQu5sGZ^KX\usySkV"9={ִpߓ^T5{ɹߞ;e7:{9kq^[X,k Z`qsh{1 ̧ ~K'`pAKf`a 䱺m4A{q^9-zM6??}Ȁ{?i.k{r8O4f1N)ev=Fr5-eAZWֈk ezA9o~tJ2 7>( "*tn{Djֲ19XϏq`W$',mk ^g=Ç*>#h||SѪ jSEo}n d)mƃ&:XsGi%DcG)&-l (`!Ip:jR[-u$ A4bZise:'yAD(q.lj^j昏HbhI7Y3#Pk,`(:K8!wlkIdRcU7<ãD@ 0I^5EБS8 i ;Lfl;jk^ )JU tP$tVc} eNmxݿ6˞H nAD kz` zA<R{pX]ǯk{puHGϰ>TIO<j0$ {RpӗN9>?Q߳T5iYix)5<<kǒsP03e-7>I#+i|FmskiigrGbٌ\jsvӾ)vZ|^>)XُH=s{o"tVOc>?EvD4"hjAm)V#hFy7>?4b\T=Mz>xj|hl88Um:6%B\rtb*[h|VAeW~Eac>'dǒ`+q"sIc{$?{|԰uƍkʅuIw;MD hI8}Inq&}h9q~iRk <'&5"OΑhxqڎc]hu#O$ 8*b<`:4[d (-k,>l'ݤk*KiPǷV5Sem:w*#[͍cѝL|U=o>5LYh fⱮT,1P~$țxÀxMZɺNߢfzlZ024?*Ow).__R}%"KuZ ϚK+`%`ϒq $J)vП/ h [}!%0$SaXy(:_'{tsO/N+DlF{Kl Gs6Kmec!;ׯYtP 0I&/tI%_aWq\>/t?d[?Jb}UTmU$JA@F(I"JrS:RhI%/ :I$'S2%$JFa@AQ!$p6J-D&3T2\)) I. %4O NJ)LRO M%JPSxNSJbSJJY(O M4 bJHĨ"% <)iQ1rHc ӧ$P.QޒJT DiIK$c$$)$)FRIV:tJ%"S$$%ABJRIJILr`SI2E$B $LSRRI%JCK) p' !P'JSJPԔI)JRRI$򔦄%)$O)(JRI$rPNSPJRR'Im*i)d)(TRRI:)BNI:JrRI$RSJJRI$RɒR}nQI%)$RFRIM@ܙRR҄EkDn)PL)VS$ $BdI$RNSI RRI'I2H)I$t)$$IӨ[JNI$ҒJRI$I&I I$I4))I$1LI)$H656:JM{B-vBqv`JLBpO*)J]2tԚMߚAQZѼr莾XAi Q \9ZEsH|cR΢HoNjC?`<̃g64if<6RjU[c`CkՆz4"K}ФJsV}HYNSHHy"u=#{w @7IP~s[Gsy?SY->8UkcV >!AΚ9(۶}1>(9.$6Ɖy)* ^tiT1wB=40[b]e-QPA;hF ;{'}2'n{#ilcg݈qxk$+mUƐ7n:C\Zl ;찝-"RsFѰLv*6 II1ñvW!1 &~B28{;H16];8U_%u{tU2<;&};vYtl K@yh]{6u#$jwq%k;UK]R;#64s%_tϜ:jݡG5)VEMJy =AqS:+.$7N[4"N7'TݞeI Ӻ#kuLBAn08"HJ3hveNU->F~IZUu3FXM5Xä8~:jwRyf~Jm۰yCc{n%A#<uV 4 "g 2~k~J"BS=0 wd*ݶ\}O1Qy5'G {/`4)V?}yiܝJ"tƣωV٢PVZ[HFmj%Ed% 2 R|Ḿ=ʬ dˆ |;ae!YaI3L.tTwoO]M ',hު9Tr2ŦNO TzUM|Anc!+4<|A'"|T "tO2%"M@I$v;Unv: c Gu$U X,s H3Ad*UX{P:'cSՖQNt*`* L4<';p Pû ' OrY" EἎȃM;&pB'=cy>: Q1욼캃)Pni(̯h9Qs?jQ&';jĻ=Ԛݣ̨xTs]QF*÷)(f!F;)ȟ$wE:rMN̴zFv!:S߹LsO-1KN^8Bd9 Ŵ[z-.}trM3+c!IAhCc6iRS{Hcs?˷sz@y 8lx7>E]k7hv]8cNQu J']擨k%)Z_^42yTfc@hη9ŖRsE33S[Qjܵ NtMk  {$? 6?{fT,i]UvCGu4R6xտ^X]#N~m-GJE^ld">r78vMs){οW={qbtu-J iiJwWo=s܌2Z\!uU_htkNVaͶ}6-1Ъc<;#Sg'+mw8oS>`TdQHPy Z}/4ʞMn>ΪdUͯZd>9E̥f-0Go@IJ+`AAm sRxA!~JcMɰϕ0m9[d%VkȤVD?zZYgii +;!U(a aH<PysI?H$ :sd*uaeZP۷dotO!մdQ0ĸm̏T@';JodZeY[0JqM" m(5h6O.XÒʙm<ϊ+s)D<'N5uvAUjө\Ay9x ?w1 Β?PwY!F^DN] AAJI:QSp:pvjaY*إω4nnDU!-lpLkL%H S/ӱ72̍nHnil{qm36g1{$ף;l<i<%Js+hX=;'odͮˀ};+' [{A!͵=ei@IEkEk3#Hq{ܒHF<u{8}-td6˝u;'T ӽM=2'e8q yjv$ZS`줳>;E<.?cܳ@k[H|U{c ;*~#xFo wSƶwhIH۟N]gpOT~k@]FD8 `.`kRy(9''IMdX[\LrWq-#PF bH]@k}iwSս\ПSk~((.2/s]cV9ͲѫDha\k Zͣk2rI13%OkQS5.us`z@x~y%@-Ov=_=JgxvebZ܇$sMp/kFԁ*pa}/JтY5±1u}V*dz!Ҙֿ,/#F0²fUj`:VOxQ`GYC4i;d3ugGmnsHG!U^1?VsDViasobMoc@[q{`T^?cheY"wد qkbNIۏh&djcUViq9coEFAMed\}۔h)Uu6cIoZƸ D~.]bWS;R?S͙\L)Ħm (Z杦Yȕ%Ʋʟc5 a?#!x l:7#zi_QձMe3u)㲃j6 ls1?Oq}` 4.mC3ٗ tj\Ai 6_a!O$ Հ]%53`[cO3SniCd Ƕ{1-?^Me?*V[[ݨ VT 3<:=Kw#%5rF!?s,` ,@wVl_Dk;6 Gтם !X-h)Ƌ#krtEb4p??ya\l/ZpH~X'@1}viۣӲ*SnE~9h\OB-q—i;>YкMMd<yZ6<`7|È.<)>)!zpşgK7on&yV694Ji{Z @4Sʍa&k~*;ŚZd97bە[<7?uOޠcI;bߍc;G6䑟ԁ7IIĒ C"Z OtСϱu'm84T,hx} ~tW[i;Jȴ%$5$RC~j"|;qH: &^CIkH;#%A :c4ֹg9$@"uh 3'g.&=dzFm*K[Pvќ$n B*l+E‹Yti -kx_f{%)5j fR<[VD?;B}!̭ŻwHjIB4wk͡qa> tosGXT@D4TH'I% xlu5 oΜ$Os h-aD5մGֆ/)5(^ Ep'C_RT2vY5mݐ@ V`N#XkH8p9AA)DwIZ: q+8M{M|վ$8levAnu l`EIL *MxCk~0_ǭ sA4  <2OM%;8L]Ai{\@;ZS׹Ċ={H8I*/a&]{JL6˫h}~B1{G)ȭYT\q1 MGjir:'BL,u)[B\4>)~nUۆƷI UeZw{4ڋ.U>PkA8Dhi-Cmnw5O6i}G9'Vmlj/sS,配& ΚM@-ԆͤgLV.q7Fpm ݐL[#_`|nL;-65y廘%`qivz#M\?f9Bs͍=}7jsӠV+8.pдjF>a9&9엞^uG C˛g) }詅he 1 !T 6⁸o 8 $/@Ni=] |R RK:jH{QuKg8FޓvIX:pDIS^uPDK990FVǴ9."Ɵ?JvݺQBi>G87O_DL;袴i:yTVlOinx ;S \"CkA2ït`MH ַ!$Rf\c x'znKXX}m'Xۧ<"ku(>a|R[kc1M ӰyS^G}tӸmpӺpC#@;()Z=o{#jCs_K[pF{gAʖ6-{F #f&oyl;Fi|U?Ss *ή4ѝ}XұcO3/6P-Z±[/ J( RAPD$7t$JRI$PI)I$dNI&:I)I$hJI(-SI%))I%)IJI$RLI(P8IK$ɥN%ARNI %,tɒI$IIRI$@5铦%6Sh$H*h@@H9ɓVE!)Hd(›PA N'PpȄ( )pdDФ*RI$0AJI$!4)$I(I2R'QI$$M BtBI%mRI%):da4))t'M BtRI$.RI%)$M BtRI$Д)$ BI)tLIPI2tI$NN )I&IBSpI$R RI%)JTR()I$9NI:J{L/#%*N`0GtIӽ@_TZ$SR1(U<]MLe;(u5jOt1/!JK{FR&kNƇIn502>2X=vJ|N$P]uM~j[=ic•hkwtl Չ!eYo67hs^?Fӫ}$[ca?GE`-oo(IP.v. s?7VAoJl~w*6Dmi5X 6r-PͶ4 90vOSsCu hEMsʥ4yj~_MUuY;p%wOޥtpP3aotrZcEmwex/~Nb>ގeiلغUk`'TG> {)1xNBwdEgkӧ))s<8tPhW4S0@W`P ,jINm1oa ԞdmC~IB3 t:j&u C&R&RjwuL)> m 0[=gVM&D$uQxТ*. tׇ:ZV\8 MЏ!&N4,T7H:(0(GEW `MNuW0ŮPav8l>{[H9gT9 1:߼nt)BccQݮ[ 9!l4Pk0[^u$*㷶^UElXf২, sѪƖԪ$ CDz' r~p:B{ּ^=M%b;3.mmgqTYdiZM])eD:.G/ G&εwxV~llAQ\dz7k+thn==>rHo*m;,x3?6A$YƺHhѧVjې=Yf;0oh6 'fwyq<4lOY4%6_ҹmv ;\i6cS?B;$gXDpǴvR/pԙA;\b9QskݴDz kpkxScݺvcF\ l+BuMu>H.D9Nxb]24=;:M>|ENXeAa &ҏQ^NaT_s;*gO~} wCM40x@H#ǺgpGe )ӱ/1/4* 9t!b/ǤK㥍pٷKRwtہ[Yg*N;[%))ma-T͹Yzof@kJ_ {l/2OCz9F#"G]K]a}N4OrVVtgyE"jII)ͶaN '}Mf *kIpxTȷ8W#J-+dp iyhc8J%M*-Pam/j8yzW/6@7iigc>¬pcY&A03u)V-9=S@mfC )l䴟R[<թ##!n{]XLqMs?#d̂&N S`xj2}.;`=JG~M sjlƧQkc;RkOuLәFlKN _䨗npw5AsudV'd=I;L?O79U6O:ziyf״6Oh@n?r)kLm'n䍎l`{,g3QSӊ\Cwf` ;޹5I.qOe }at%Sݲ~ /I쓦۷m>MnwIN8U⽖dퟣK9dZ2wEji2Pn3nqk?׆8ϼ4x!ݣ'sG\?%7F5Q`}D:jL+%ŹE6\ϧl`?R:%kC'iǐSv,R0涗SN},5ޞ32G0+C41!+ol863{ hʃi-?>L0 )F@ #[f^2OPq6a#UmZH q -t>[^eH&dx!6K m SP}W%=}{qand4< p|OHlȐL5ZͣIM]NcɭԵ 눇 b"\T9UL}ީ33@cAG>hT@,ǙIM,!C(e^5`ɏw*UMRͺ\ܐMmg=nG`S~Z d㹤 )v9wKl?Hٵ߭ΈnmͲAk][{*>_XmkX[F;kAl4GeSվ )`뱋SĘ&a2,!,G6ֺ@w+5ZmF'Aq&;G~ }%9y-qG,uu4X@YEh$͍зH&|g %ܵLDyz 4tC[*cYH-c̢ Dzcrpu[k[[⭻I# z#ZSb湖]WcO`;ӆjNЄwV@AeM$}m"3,XA̡EuFRk}5Uz,/k]Gp>AArFk#D==ďVIhEf0Z8Yg:5ͦue_kAa2+=`c:[qv7RR7ee>'׸~v۪漢n?I:N ?}-qI:=C4Cus=SW"c\ɭ8%^I $܇ԝݮ:~ET-"L&4${3IC=>#p\L7p<$Y;iU)ƢLoڜ [io,fYum6?st :n?FnϨ6y>ȉo3\ϲ"Nn4g$D#c+594w"Y+hTCK\w'<[! mc׹A#=5InA&45ծq_}uv> q._KLd?=aiz`@SƷn}?X{}a$J4ʮrS.-Љ3V[5H;(;D%% C`kvX~ whSڰ:]ME %Jcjt7a&'&uh:)HkAc)un1)MtR=уFʝ,whHd' $VAӺM6wtůsM3&=)oN1b٘ևe0NxOMn\ۇfZBk >i6潲-)z7ّ[=>䔾 Eux>[? (Dm~ʖ7Lʼ2j#~zEH6P7[-#HII[A9E\mvfZa~zΡθŭP~;76Y1r[H rcTXw V9ZXֽ~簟kfc[cUh>?,gD.fFE522x#C@uwo`'0v8u&*h_cZeLif7 y5SKs*Eb# iO[c8Be{#X& :10v]C+uE2LI6!`1 nvýrH<4lsąyEMj N6C]0c\xzѯ?Z5FVhȽ~ճЀf?:[\Y0cPF~*#k㯒k)@k7LeR[ IBźc=?[:cݧ{N6xۡgrlvM5hvR;) f` \n7#\hn}k͕=SRs F7-mlz}! aC] ;hRRKq)k=#BT$M m$]eq$j.hGښ,"X!ªas˱Es㴎(l۳hm-=>J=_7i?Im3d6 TCMuV,k>5bpɆ#󂙸i:%ElH)gk^X_yqvV ? Z xB5KEfSZLw)7=7Q%7*cHT5CͶq:Tuꪷ"ɲ/,%1v7k.i읭k$Cu%(Q8ېw25?Pfms7?qKU-~puPfI|1GO ak=dL{PS sc_O nE-?6?P~m~dj)k,k6@$v h`ݓG%6}L,&[?2y/q<):p\W_[[;#*k%ѼcP7vk:J_OdwSm6gXD܃icZ׿ø!N}r vwΧa4uNF͢tJ$?HfdCF\FO*w_[H?5ڬ:Ml$I3n<]_VFpTX67WI(gd)nxU k+l`cdp'5Z 0D+xTynsS$[*Lʤ>+[9Q]D:=GMLw55ѲRR*-! ڥXd$rFp,xV85.|TZ\/n1ˉ}NzŧNSa] T6AmRUM4HcN7w~%5 6 >#]QُkC]-~MNat3dxk(gw>`?xJS{hRw49;[Lh<7Kl)I3 xײuKMQIMQW.V{ )3ehqnhẂX\/ Xh4qҴ<ƤFSwJm6698܄ַ8wdk}?!s>0aH lHN`{)h@}Ĩ GK9QsC&Ǧ\v@k~*V[iy"\7<%RM(y_67@ Jk;ҏ$,(rYh.'qkwc3捣Q⊝]y_neG ӎkD%K#".ĩT^u>Im.Z8f J@}? f7{GpP}i{C7 쁠( i R>߇ucowjP^ߥJc <Tadu-?aY<j,x\P4L}Zn&8? (OSw^E~h릻]Ժ#X7VhtTTgXIBcZOQgwD0oI,r:Eeu~ G}h}U1;ԭN+~n?,?y|Pq8wJCb18A,(;*4:nEs|2Pg y0;5#)uֵ$4)&f PFH.q. ^X'>2A>!Ca d)JJ]EG_ahx><^h mf[bnnl^=^̸*a..}g4n/-qLqU}:NpQ'*2Z+kH65: Z116 7Jot׺o֗b9Z8mw?:xAopvNiґ4pht)0 `A<:8uՒӸr嵋2 q} }a5? /:-ʽz_KU_)vQ9i֚Ĵd^`ұKxSQ:yeMp\I$I$_aWm??*r0CE#'Uk~VU{>AL4Ӥ$$I$$RdI%)$&)ڙ$I'~E $T4'FTk'J=0 ܐ r$JRtIJSBP%"NI$铦$)I$IJI$$II$T铧 II$$ҝ%.I$$xIJI$eE*7E5'j &L1Nt)$&NS"$I›TI!ItQ(&{Q\P'U2R$[BAa;xN'I:d)I$I$JRI$$IJI$I$RI$NI$:bI&N$I:dIJI$L$I R:NI& IJI$I$R$IEJI$Qp$()I$ S 'aDd Tl(V4XeԠg8YLUøxU%IAK\j $뢔)Jw&ԒtɒO1IKIJyLJRI$I$I')QO$I:hޟs4$Jɬr૦WGKSoF+BTwgR\;yxY閟+R Sq%G7q˖QLzDWw%jtSwPwJGc+ %з|IDVYܥaNuU!k8 ׺]8\jރHЂ.doa:V RuMTx) jziJW(V 7f%" vcP Mԏr)\gvEEw$_q=O<AH)+SM.w%Pg^7t)yRv5~}Soo?k\l2ө|W kOwMh- |RS,i W^q{[ H+TvݻՃ7t%ė%)^tαKNѪǗ9;LZwth*'b}. %)\ _Y2ĒdsL4\9 .VqĪWg;F©S* OG&;\~Hejnj,̦触\W`@vA[fôNGsrmԐAĭPvSgy'"6D~=ZtFO5PZڬ$t58LhӖP?A !<ÃHv8F3̖XK\~rOtD!iÌ( 0yLvx()}u{G!u-tP[sNucG`yJAձ#;>={ȃEvI-~ZjjjdWHc_K˜4-!X~EXNv񫂀qY{SLywߩBⶺ_w+I4?{4m̱Fcuta=Z~E ^L!?AH`LCF;kxG %v.ypWlWm$Rmy/\Ө?xuD~a:=F[=,ޤhFʳhǸwBɶ|T'U$ eU vi>ձҺ 58e_P,pȰzNl}w=[k~ G*i%^:4. zkƫӤ%mђ,1[c"e[kG^GN6ke TtƲ%TF@n`"*Z0!q2<2BWٸp7;cYief8  bմ'l?%[.= o{”L=*Fšմ<~[hʅ-X%&SD{|AMRw4 \U<؈@NXװ I)$n3"u* <AԔ"v9)H4SPcJ[C` Zڞ!z ; ZvCeO{Y(u]ѰaÔfX*Mī`xjS! w*G*\46g@^R;B6kBri)lQJ*d<5UlV=B+p<ᷓEm#4[6ua½0מT\; 9A-U(ܤIe<|PJu /hB$ҒΜ)FFAKbc{~*vyM^^Tlu 9 Bt@@vI%I'LJ*0RZI1 O0\JJRI$*!*ARI$9Gu.I$d!TΕng Q-5n+O;AQ@-ybȐ]\9k/sѦ- + g>c24Sc6sx*du Hhc7]չMyoeQ3iktےlvL%m-ۮFc ;w"{la-ਸ਼AAN>_VYm`:W1}ui.sA0I>p#[-pƊnvƐ>JaU} NʱmVuc*{ȲY2U,Ȱ9j܇UNk.la-'L/5,Gw/¶z1e FH}\ל`@>R51.qcL*')&{OPX53*7f<iAV㜌Sk.?FMvl{Vmm+1Dk&淒wf5aYGp׽tnaO΀ah>S{_wt >nu/q9ߛ^1i.'bcӻ Scw7T-ù$K=(N@I@>GG4!ǃS slt\Nh3s]gN$0j|Q# e jq30O )j+^9 }*k_:H-RZ Gws*`ketse`aÒ[poúN7⒛Y.,;4{cy-di_7܋^FOٜu2HՄi%;-wN tz -n'$6JZXϴ52B1+-HO*J6롏|SPvax mB .pwDmbI$0i'ư Jna5UKrlVw?V1=GjDm4శ ja^4=})PnoTa'ҋLj 5WvB]lG| s'|nL4h䨈kEmV\ѿ`Dk"H8WYI9ִ@T-߽zqv$dzIAvwv>j6Ȭɓ ILqY.K 2Xk&0h5VXȦ 6{.x(ޑ q=v/wJOnN9׌}1?\j}eo;FLTwCwO53zvH&{^\ 9I{`H%/v[`{ A4Tph 2{}@PwǀP?DHtؠb4KTG>5Q_#lw" \:V:{9cq$KOk_V̎k%#"G4Rlr{s(sE1e@]n06㲍U]Akmljbv V *7>*a!QnFԟ1۾[mt`hegX[MV 1TmXm-v:rۼ>mICjadrJvWQf99M]Ck|PRO -Β%{#+1[)k~K>qm(Y8s]jgDnOTkFqcw&Hn%76Zjsu#*hk~Ǒ4ϾL~U)}rqD(g5'DA #h֋$ s8x/kElN\p[Y%jRͲbem8xo LJKhԘۤNJf<7kOt]pСe?`⊛'h";KǻgҳRik8h[Ѻ]0caPqwݱFa#&'iܝz7/vd9I ens^?0?\3S[+wgu5Fɿs$AZdQ'`!;87Rg֖=pGc=r~-ISe87OgJj>Ð"AdF$f۔lXA>)h 8'*1*K+taֺ/imqPs5XK[slkN M]:BWX-;YYߦB]/=)ḠQiH}F ( ܅R=Z g${䍕gmb\4 Qm' #q!f-$:FĪ}FAouYQnN*\a" R\=f*/P.>bkG IM|[9ϼ"b1,iqC;~'ಶLqVKuخهk`:fQfx9^#70Nùv#kxIMlf?@]}[EQ.jی o&IR¶>Mn?uHTTkE|!GvH !~eƲ!;>Vme0{}uQ,MϝYR"OHO*EF6xXh08z eNf͓V&1 3ꭎfCۈ7)ͻS=u~ŭn쒔FEXqȒҧA^;cG-'OuuUsSfEKӣJl󹧴)1ٰ+c! [xIM˱ fWn gS8p7ߓ_}>Uj3nCK%Фݱ#A 5ӺF{N S1kGt׵:s&b:}^..p3C"ql&5LpK#Gr?}@\ĹOo4ν͆9HxBgJN+lmzL%I2K}/.TYQ9pv1molm?6H'۵Z Jcotf9RBYkğo~)Xd6>^-/u9?Ժ ZC^uB4;ʝdLzhS p'Cݽ2CLZg/m>5SwMsC&!.Chh$0IDe͘ ( 87iSjecְ LJn-p?:Q>0u=>GFnBO@!0,stDּl )+pc@X9iQofƺi,dTXX;_yBw;nCOpT3P5<=w}AA4KBG71\ 9yd\}vY`gGe(cL[DC T}D0}zɫ=i`9MBΡD04}^k`oxR56DHvfX#ڙXg9ا'g\Äie!eIT3=.[I7!]nSbG#e@qЎ(3(N|}-h3Q>:|R,Ǵh?QS\LFm7Z?2?ydsje.RUY_ .2{$<}u fQ`V[ʏ"X $ q#৸% @V@> A5R^Qd\ 5.svƪ}Fw>H_#\ &BqT  3[$yU.'}'S☑xHD;s7Ta;< 2n 1c{y(#OPBixH)c`n&qwdlZk0țTI{Jq>"5pA>eYeHz1i qN&fOhn3XɓRz"=CߵC 7k* [N9H˴Rh;G>)JfFcP]hy͑5{E"]&{t:'51`}S s=*X a!O1b;7VwCt=0H#R/I8Vjcֻ`%T55|#{^uN> (Ȁe W65e4APvAcyp{<)4'M|֜5ܒ§tw#d;T ;&6=c5HR5.P1 -AR6eMlӏR'젍KoØ>6 ʓwQ@%)k*2 ǒ!HXT [8TU`6HSts7'jU.o'H04ˍ@k.n^4<њni FB1x U@ߤe9lH1ա {<:=̩LC-6W_eeψEmN0p'0L|返خI^qGdeXh{j ʹ5NxLĈ:$&Xv4|[%UpС %YL`ߘRV<8Q ûO yP6ulA xί=YԸ!=gq$J.TK=jeѫ5()mMMp|uB5X2g^ mCϤGc,󱣃)A۬>P5模C6ݿ'u TXtsc5b}'vGD2 us:ohV4wyCaH#j`LǚJOKp?j%B_/2t|cN?}&Aջ'ASsk  8=юѡOie 2gF$I))i}aO8p6G%fl#O:f[cTPy ,{[cPa>Otv?uk$SŽ_`n4y z/<)8)Ԟvd!9.DvIHG\{FaSv:@T7Ma' TtCc+:Oݣ5(!]Q|lFCm&O(f|}{%5lF{OQ{'6RRL;6Tw\zT~Rq-lkg$] cv4'zMtD*4{\茯c=V KU[e 1լU(i 8Π vüa5DHH>]>5+ZL*8#eDZϭt?`ד4i)ƐCb#SX|Q 'Q! {d2{=i-i*0wMNv| g=TSm:Di18 |RRhü]j>e!m{UBRHa*lWU͕48Ȣ6֜=4#A&'_oJH cزIi'-ׄw8 IL$K n.qc9t@*g^/sGmd}"v3vP><nI*a!NK|zңu= lt< N#+$X9W=*w qĐn0L;Dq{J`)@wVp7ҍ^c_ޟbHk]{=ױ^ r856>55s=uz@{_ӱ<.e$L^$K_aWk??*rrict3ҘUUEXUE$(}d I2I)I$:dIK$$I$I2d&IJN鞢R + rXJ`w(JQSp'L tJRtJd4$I$2xJRN$IJI$&*P$I')I$t$tN (RI'RpQRRI$)M1IJL% aERLPR8I%$B铦O)&JPRNtHdI:p8 %I$ D:TwH,JУƒWK)JI YBJBD$lDI$$$I$I)I$I$JRI$tRI$JRI$$IJI$I$RI$I$I$RI%m$ZI:hJ6yJjI(LPH3N<BkiL5PlvOv=א8tJSJfi<'4)$\5-B P8nhV?IJKQ#/LVS,0B͈쮹P6J @~C@/*3%RBupU dZN BBJ]2RJ\ʃi ^$LSmNݭ&}bqC^xIJ<& ?jwp$U mJBR뒘d8${)z5%jJ$sl#:A{ 'Jbƞ@Q=>9 HK̇W!=z& +0[ITX,!&4.;K<@g;E(.p:$Q7A[cW7O)fYah?) L+g 26|nHO!uw4o)Yױ>%˾`o`p:!I%[kpp>&\o]li_]ıCˢ-{OyӋ*LSOwl7w_ҳi?NWBP 9H)yνzUfC*U_Y1 zadkwKŸCoܻ@'~^'ou!I8:DrxPi]U2>f}Lv;Ԯ?OЪX[ x$M~(ƂtQ2\ӯZyVis vFDIl )81a9iw~\ 8ptw)2u  9IGF>{ 9͇@ASɖci<4N5I0le dA!ΐ !3AD_DgR&\ N&c@ 4EKX{5߿E5QN׍?*|hdHRS3pI:v!5I类nCk4*cCN%fH2 nuDaVq.vXv(zF&BJmLJVd=sʻ%)tA"TLQlb @=/xqUikgu˚Z4-3x)G)mjGT|NJjzcLyÐ^;϶`F?XF9.Rm?Euht>*;IK?!G M}!F= i^km&+"{Y['lOm@/OtĐ5;cM v1uښTZ͸kOK.I:}%_l{ ,v ;!ͩ՛e%]X=7MβU-KLW1ѲPk;seV@`_6Nn*V+B qlќ8wu|UZ-u"vCvR*7=9.   l6ꝍl֏w1oY򫁵ثKdrwSxQ07093LTl0PDT]SpQhYp p8$J `QZ a#^Q8@F IdDjȎLQϒL:JVb g':$BV+XU[|Q))Ei Q;]U܀:ʆ;)S[qN$i1!j n%t#iL.!Q Ǹh|9cXy?[L6`[ZN w44KϚ;>O0͞jOH3j?k[Ux*C]u (tz6{C7O5rTrjiaq H4$/I̵`yx1⥉CÉDPc&MSS{] Wۧ1$e켆ճ.=JUEHs6vx=񲯨$:z^@ppQGOd6֎D RF+iiV9T¢͐c^"Z?;,Ǹl:4Z98,"aGs4_R;Q-.ݸ{BǂlmAH^6:,{tF ~h%;:q&?S>Aa;@(վ&<'N B`UFZueB{%Gz.gѬyZJCNK^ABN.˗<۷XߦPU%\@`cvt$E"IZ86` ;WM~CӠ!H5j=ӪHeqñ4ƻ ٴ H|j .,ƶʀa$p34@@G~D 'h2!%)ǐpt{w~m$8s<džX5_zṳ>XSkvϦݣmPd2߹|VCe̝Ot׶ho6;R^u۪L)QAzqY kѤ{?ΩcBa2:Rf9*-EK=FձrTNSMM[O^v{v.jWu*xo9Q}I%;&o(}A/|ў洏SRFu> `QǥQ`8'OS#&>1EZG1)~ F3\N[{B pBeRShdnpwjLYgYV@,i K!mnuO=՜1]," ϹteMD{J0wmLG()n3h<n%v] F3\]4[V+L<j-{GS>FkD!S.,g%/DHY?KT{N4 UrknxܭfS \D NؘpvQhՠNEַqkw );M=*aoQ }])==Ϧ%" )ׇiŵ;O$t`ڥҺ[m@>Hl )A 'yU B[-gf[H8īVa6 5O]":;\Z]H> m#9 )܂*{۟edzmy`hxl}1r.5-yxE}ä~r.۷@~KH><0=)Od86u>o*=OsgQ$cmnh-Ɖjb03BxI=Ef U owiMKsm1lCNٟWܝV5k֙f`s]Y钉]mۼěq MiLTIܒ7-XYtGe:֌[8JǖRYVxUO>ƊuGpeDG~Aw @RWc}4V+44Oc_X[JYq]={Z+➻ tBȠ9ۜMr;$(kv[64C+W7=5V_Psi5R}pMQuʛ8IC{h}%gmgpo0Z-x n[l4jXڽKZ̀-ZQp۸TGYWOO~D; v BfdiLL%뵮 % v15:)a:x{Eּi-R=:˩cE.c򶢺%e շW [OSѹ{AIM&>ZX`)[n_ o}' 4VM̋kmq:HU3)6H;+nq녀bsvMex$k5Պp_X@y쩕]Oq8K^ sn%DN˅ZؗգHJmck7;pMwNv9u{\ҳUK8N[K7<@ u'pS`x;F1f[RKcҡmU>e ߻ 9Ρx%̏n-pѫhEm$wElrÈ(zMyr 4 )-X웃U[[~;Erۆ-GṰ{]/8U6`_Up^6ɏ05A撝lƌ--}v4K0~$zz*>h#?j= ̭]$I>ksKÃMsIpԑ)'92ecG]flHtğ]4Rd lhcd8;k|ճ> SvxI,lˠOq:"U},/cǶƝ7~ç&E c{DLs 8Pk-k LF*E LHgO'K䒕~U$=XUZy|R ۄW!k4Q?PCI`m4;ix qv%7 bd9Ā{zMظ9z}-#ae=:NC!~Y j3:>HVK>e){64WCfv*uٶ^}V2v%mLEnhıyyX1V OoH{udp$4vIK㾦Y50ے!'J!AOn+v woYÅ'|6d 7h7to0% {rXdï+YA'1U3Xh5&CElXZMs{#ZT[؏d< Jj]k7Kg dv!i;~YA9V  [j ݔD|RY9xAHn{o 9j d6%QCr6G3GK$v'5P+'ls̓!Jj]}-}J-P5V,h $9@QgFc{LꉨK~vZvx $vI;"f6f X3_r9,kEtmoc׉%jS7*j \7{nd6l 0"fyJn]9._Mtpq8}!;Svf0`.fͿDJN\yRY?&ǥfILe~=cQQȡhs*hއK\EQ\{\YԴ斗8 6V<`r|Mq=y t<#[o$8n @H`[}';X[eazt` rmXˈ QlAD)5a̻x5Wpsc>}/V[cϤ956w=@ds6iIMΤ+ufր=YlP{K;w Ig#c@61?1+Aaߕ()0RE-?U#[miБ /(/$ŽchDJG:j1jDHhgk,Z*.kd6uRcKD)}!-~) kIMdkn!`fG:GvcÆ eJP_$ $A}>{Jkqq-A=OqL֐t kON3| ܒ.@'XVaZ-kMkmm5O|}QMmwGAIMciȴcYc jHeI[yUDK{>as8FZI>@a3:j)0ôj}X֏h; .>&^4''Aʳӱ1\d'; :0xsdgFNS2@dXSslkiT[qݍwʷP4 NGҞN?;~׺ d{% r߳5{\KFׅ\ &# uHj#!ao48X=S{+,W&ΰzpGH}'|ml{8{ZYhSm7Dy$]䒛k?64niوwt 4NqS(5-ly'p;A%6oMlLáP~&;}' Q''@) 8N݃Y$k4$7_ZS}v`ap}Vcܾ;BEֺ\7O'i w EAjI^^4ZZA;Nq\J-b\]!{Sqanq::X]`O4MgzotBq!IUV!.>*Xf3gw8Nܦ[45*ߡtILUWll'UZKtO-VKvѨyTKxrBgO2#;[ϒE=ȩ{m(MP:OdNQcC]?HuNa P8%*oYj7s#RPӵ{{;U<~u}1[kmPpAyo_ӫt‘h'M mӹe}QkGچ*v2*H#@t {$iham=HB8x(tk+lQK^[ksOpSckrI1(`YMnɹ{t梉n! YcC`3߷|H)ym;Q6o>c4FuKRwTV:xh{cn|CYq{d  9޷mOT Sh5~j ; T- ϒZC(7Q⒚6r~&ݠ1eask!S)8Hj]hMCL!KwI)U`kED3k9<.,s뛴ˍ{@9=`;ݫ|0˽hh 8{Qɴ &p &: /sLPDwp1XE9@RpiIPxs?Ro" J`Ξ"v Vlaې\ƃ{aYq?j/x(/4kJkA'~I''\$$}A%Onp_F>?v@X e9x:%~rG*Gl8p;/;we0!ߕYOJ5y1zMtjKzf0vTWY:~Wf$T?%$I$I_aWm??*2\n?Hc?)UZߤURUxLZ 'T -BF- )2H[AW v$RT7%(i$BIf*)L!R$7虂T%E$mI&js(bUMi8'`CjmHPRSmLZ˂pIKyQDM#%/)a-TbBg%)NJ(]"SТB>LkCܜ93$d2 "9%RANENQJtHAUJ3I4()'iOA$S dtJi@!23Csa$:)a(ShRڂt&C )TI$  I)I'I-5T@$$BIJM!XiYu U{^{,ڴbE`AGPAVZeVs*qg$Œ$:I:I% BJRI$e(4I8NTIJI"d<> "ԒIB$D$^RDj$I&òPJĤI8!LjsQktjLR0)4<  xRR_ҫJqYNMq LJJrpPC#\iDIQ)*Dw'ޭaݰ~(X0ATϢxS6<ęAuɨBDBAD1hf#D(%HbPB) 5yNu> Q(wj$'4LQkA7HM'"JLKO(jPecT'.)K}FνNdW({"48饇Df#P$0GwdO-$'LAXN5٪rI d󦉤QfgDn"&SOJ_r[m R`#)HG J%6{m);PՐ7E㐒 Kj}(NQԉ8RRД'I#f&Dr'jJJR eD6LBhF~CO|GJ^Sk#}jiQ4VCyJR@u@]d0yP: t!D+E3Vxsd- NDf;b3PP%R0n=*zcbXVm7>}Nge*r_QА&K;}i8`dt\W'CWg1Ր5 Ä+TÌ+c]/^w MKsMk4., sz`ki#B?\g7d@?+\$vH ~8Ud}'pGg!5O굑[;7qrp,[·xGL擙ߺv:MTn'[*.Љo`T^g*78r;jHlkjo%ԑ6p‘<Ԍ)%3\gN0N's9S4a$$"xI@{!^W!͈u bầO2 7'5ĴD$\ksIH[Yu 8p[ihi})XivY(57B7OjOL!BZyF/qؤ-RRjZG+YyZ5}EV;k>uRkA$9 @dͩ?(ϳX^ xpɞRSs7(=ߴZ!H̡uoԘ>Yi{V.xVC"_tQohPtO|?vL[3Jՠ')lsKHGUBF d{l}OxrfV <4xN$o 3-$we2{Ciگci;gXݵm9{J>]jΉ2LWx M{K$^Aa1#B:1:C 'edb\ܝ!Ǹq?!`g1}FG%6j-1;3B콿Mhs?ഛfⰰ@?{kEIʛaJ2Ujl3{.&O+j&;󞪸2c]BUqgNG@gM ԣJ`ôGL4wJx;v5I@M5EJ{4[ldT xD,(V$R!AIPߴ$ jfƀnLjNRoj6:8@jX %aDՂ% RG( L)KViH졢2S8 9Fq]ݣ\?C3sgv>"`wr$-uyTڽ;@~딩hZmfA-omKh~awCe@$ni"v1&p@CikuC`sXWQHaDk[-&%Xkm0 ΅JnUEbֲ зIǙ$p%w~u:-^{sd8rSN?H1ӸzM4 ,OzPBuqm }>?߸NKk\@h͟6sSYYXRp@sݶ8Qk٧$&rJLLb3udpB.. {70Fúk&=-KmnLPFqDt✶ Zt*:'qx!:v7rFBͲ Zed8ݸK*՛uԹi髙=8i{Yt=lotH&dr6F݁EƗZ~7VeaVq`::myE`SYˏ(:ǵ/4$Vt D1@(Cӛ=Z[~]%j.DsLI1;v}Bˀk\=Qܛ_ĖH:̹o :JURTgƀd]dzy 4eJr~{nfƻg䢚C"ykyEo/%&Q4[e  6Rm mkȢfa7vn!|?}X {7[UAIBn l+. qANxpwCtJ6N)-QrzΩXZj! HI(Y h#➇zZM3 XwA c^~?E ]<~z6?K7V37佪.洃'TSX}=qlyRcvPָZc%".7ZKvgxZ*6U2(-=`vV2ǻ _it{D)@l tpIkӕ͎$)-qZ}ES!u?O?R'Y-#Y}eޣ5wL5hJ͵cL'.Yd<TO 0_Ý\AʎQ64Bȵc>ݢ5Q[Hx*RIz| PpS9}GO쒛m׈׶֟p(N ueDL+X4C\\1XfFk >y =]Y=Oӈ.0%ME$ގ`coFO0뷳irkZ`oPʞ=[3KY?ǻ) ;w*ףq#IDl'2NߑlK^,7[#nTHdIVnPߎ[6bS& 6@N#zg%0D56a'DK:[ {uecefMFcUg2]0^r`a*sH _WC$ű K,#踟Bށv}1~=@m4V][9BO ; 7'5?{jq#IMo}kZ5V.!h>hI)gN~G,ig:il|J6݊^t6g = )/٬.c_f%.X芹{2H6oso"7G*ʻyqL{HGnôH],'`usGTVzBooGΣTrzS ;i#o;JYjϚf2bҳ$2cwUWtݞ?N,y3u)(KwVhJo n*%j8;l`H))32k4 lo?M[+" Vls\{ƵuS5 s\u[Y!҈wiP2a'zw?JmadH J8ozpVp]xa}& In.[ k{C_nKN@.'Dzq| s~=!uPdтnhQe155m|Q4c8_ipYp[;l/۷}1x$NAPבΧU5ku0GoL.4q.F,h%ay$=ٌ~VY"KUP2֒!uXk.-e`R21_ sۯ7xls*|8Eʜ~$(X#93 |B_(hZqiNmT&}HEnx% N|Ge0 {%4;K߾_c}8s}l3ɭNh<vq tI^ #w4 Rmoz8x5״3*:ʃIUe{_{ drd 65h'{l7HI >~?4h?cDk'ԡ޽q~ [u&L Hnh;ϤFEDV@yOa)/7>oYv| \k~vw0P+h:E(~0>>*Nw0⊘=- \DI5嫧VZo{Ia:6dT`p S55qL汏黶sqn-VC {o}?owիc6nv{llumcSHA&CD.pBRR l 5䡿&.AYښX8hVxY-e#uvzXNBKjP!-[rmfw?+; Nյ[C:ykw! !SZu<=ݕVhU8pxC eI΃m?؞dJ\i3* ase1qo>)yhDy${˸4DCvwOY pEpF(89Hot\>O]n-Ihݯ(ءy6oEZi.t}xLL2$ dI l1m3ð(,k?X;}F*tv@`FiX OKI.n%`[*6>d Cx{C@:!Heǹ $!JwHơk!p5q;GwUq);(6aggsdfJZ~{ISk{ALjםE%ԭk0kjv-7[)cdF@ACX}I aVʞ6*S-yBBo \E[}:mq 0D8ۭ|7)Xd,.mi4 6%&?x[Z|'T,7977I?GAhMqlUt<.(d@6""f1d.-}Π;43l.[k:)L-7k Īɰ7۠Of;bLѐЎkʞ`iρCc Din)uII.r\~r506ցF63ր52~}l Im-ϯ;Bv烦|Vp7ҍNc_ޟmbgksssӚZ!ܼӎZXF_/\Mǐ蛠.e$L^褒K_aWqg]g*o?d[?Jb}UTmTQ{L g@fEڜB[TN\SS;T pZSPԶJtoQ BRijDBFA&ޢL MJOirJbfSJ2mnIJ"Ҋ(I1LS3RRxH$S&PJ$Ib$*Nǩ ˒M!0jP6SJHZI SnH(IEYR6I@(9r{k9 ݸQ#BhR @-T&#'AMI$bQ%Cr[U II-IOrbT JRU$'J%4 !I$;PM$SУ'J]EI""9T!1M!A 8IQچ7;kl('JD-P:&w$h~HZ Y:PK`mAERG:%kmhO .t'({$^' @}T Aਰ;PPR$mO 0`0jJ%O!&@c\9#lLW%3)(L\yFeMN4NV|(@mh(lKkX}ɽIDO <%9N<[!3ik⒘ o#t:D'5H%.BdSʎ*!4QX:k-%/(QMh)v4SEK ``J5:xX%,tO))@Ly'!Nꈁ()I5Qx=Z׎b jHR{8$@A#BփA]S4ZIS>)u hi$(픑]{?eL {IKXi$B[Kh)$j\t !RҞM`'3NJJT<&Q"t!HADR- %tڧJS&*]N]):PO:)$r OƲ9osxy' P "\y" 3B\N6;PT=$萅VA$L |Tnk's>tNJP QQ49!8!iB}!L% Ô1:خ Ziې6َpA@<:rk=亷0#R^s/f "!yS ~ tfN<\ ?v.TI|ft3Y5dqˇݸA 暗ʫcë1ǚ;ZyF ̻@]"[:JkQ JZH(N{0 A 儷S>iJyO–D 4'@$F ijKZo2BnSl )8ݾwO+om\ʬݍ3?yBF$7s?Xr%En4P5WG. kmvzT<:;I,d\{9p擫O!\5ZVѸ~E'^JLyݤ󕥋sl0乼GSyך^;k4cD!D|4eY >I'-$eTv6ʅN.$|TZ t'Z(1xh2O@$?6;sA5nBHk$!630o[ !2KtStU4Gf䒎 KX૸ADwxND T CotkJnfրq炍CITf^84Bt%r-L0wYOCuU*:#b6`N&R%BWOgn}L{J4K45՝J>%Ux WI#ħgD}p#4`R*tqOX*u tF\eI( dBC>"&|BO*0'弐Y$uJTgCBu"F2JrTt.wD/BLPB#YKO(?F|!Z&S?NxRkj3kJ1[<%o5!ٖ1s| rfD7kZ8dOut!W,hGD;ySQ.k# q_ɵ99{^k-7%EC{`)Ɖ,NI OSeEO}i :bPm-ݨM6>C?E%GdDTAe£/$kkh \+;- Edj#C\l5R[ 6w(AYPmdmW9Ztpìzd^;Vf3Ff &c*:7{(۾׷ٻJox;-<|Ѥ,{m}=Y?hߕc"z\~+}s{7֕:m>Иw1d7$o{\Z@>IT; cb!扨NM=-vqr??ʛcY*ō t=fMcGGUw@Ԑ\Ƽg4f\=Z@?wmpLAYQEDG9jRrW}Bg`k!+D=㝧eh3hw7Ve=4=GEpqIS[.Ш1M>C7ZQQͬ9S-[dbhk3n;iw.v@kWH<'8NSLTf+nIXzaI72Gǿ?oUM}@y<61?t9΍Qgܺ2Ak[y6eA{iCE jF9߲c;P!ʍK܊X. c@ }%Vc qKqH ʞ> Aj0nhA{}~lelR8ipIM+o ;a]ȡEͺ5kdc{ߍ}$D9YNc3&9l8琞"6v2c[CܢuԹC&ʡsߎ5u]MP |?yY&uέTN3$F}GC=!5o ΍A)(n v«?nзAUd"wg="ɖ v=GIЄ>ļyܡMeq3=0c8^SD=Lg}vKlkhٶ=* fxخx5X;oK̬w0u~QKdJkȴGcVqr@k+X6VN(Z 67&s$Ɯ{1 )rQ "U_R0:Ƹ T [w%^T;ncjVmuN{WC?5&tTtrJC--/k.{s*gZud J]HA&9CT뽡7x#*gwn6!wpD=Ғ*,6wIU#v:9K'cacݯK_t;2Zu ɝ"`xӔļIB}Gj%61K8}9)--},3v]Mm/{>Y5Z߼܂8jϐ'MIhwIH鍥e.m,yeh{nQ=zN;q=5\a<$OjO4<ʙq+h0HoJNZHa`ж0~IW 7?U7}$fvc{n0P')K -H8pbJ*n?g#a>5 l-=;;,'FOq^ Vvn_?E ܦ tג8&$>*-=*Yo7cVgdT>pQ}Cx{pvL x:A@RKsl֪eՑciTSu4wC"#Zk2=6]Axp>#_}P<#j҂5\*?cqA{uZCe:yRcEFG{f&uƇf9 ~wІEnv4 GUsCIt#8R^;Or566ѿGNy`8ݠxIIe;rIu"ʈ6ia_]Z̮ߴ;;Z-{'GI$SyB6i0L OMsaSHpY~TVgv1Aq#tع:4h?IXt;/eI9XO$nHlv[K'j % 7 X?)otޫ[.y!lwJbk6fK'Uiuk5lSXÒ"ƸOGlO~%S& B3c[)?{hcx/`}?iu :YW7wՖcmQ>OQLjb>˄3XiO!i4Ա!iƊՍeݒuh>%8s4+U6-&@HP;Kt|ҬӴmRS Z,V[B&gp$- ϧ*ylY,k♮pMi1~oqo"]m-rXʜ݀v e6+@ٜG`~5hWPK}g8/Y}DtCq#X(mt=D;;n:a8aKB]l6pXbM :Uca&_›]%h;k`?L :G%5Zh.WDnKu=67cO r#ڦ+pن[e*٬H.N嬨xs7IHr2ٸ0 H:}ןR!h*p G#"_?1.l3ٴW6G?7k,!KdY资 }6?@nK/z12yD[QiaͰƈ&k{_li2us؍<4?m6btވG&ch> )fs sR.C}5>!H [Ygwk1Ģ6VXeU~ JIsa*9 -&xZV0$τYٯpϷUtS;G= I3 Q(m22Ѭjټ? Yt9M|ٍTKOtg$ܢu]4"2Y> 0 4[F )MRO iX ]xmcIL&;@ OdO SD8ɂ @IumP LլOe #dʆ#iR^{{{<3 U;}sJ;!R$s+ |$]a"J!~,kOR6t◩T͇h&ӳFꊔCkO0j[y7 l %;}Mvw7Ǝ {q/Ky Dt{3pq )-phm:;;dBko !IPSG?_t ̻QC'ZyIJ8Lq<BNRQ[L=qPT|S8{y*%qJq[[))Ԇ4 u W5 l$Gn@-QtDpN%x'u;2cqʎK\l>8*v Xa336@☟WS1;es()vaCw US1yF3{KF  n*%ѣD# BfB!I6cϪ|'oM-kȴ=`ch:G> / 8;lkFu?8 qS"6~: [x-:&lÕ-vL瑧!0x';\|JApGp$JONF8X;KH4LlARk0!JuLwII_s+ddCɘB9SYC8䕔BZy"JbΦ"{;KZ{[eP% X%uBIXE9$>h?GI:\NTocBj977J~T==RJ'&j:  腟._U"!:boN d$J^RL[TQ7(PME4)&$ВIBJ]$I2tRI$RI$'LI2t'I)$L IJI$I%*I$Д$"$I $I$K)R)& L"i$Dh""$M)d'1D1)yO*)(lPxTB( 4 (bciD&RN4(mLB%$/)% (xKt%RE)&BEN!*JS$ HN Z&'&ܔn 6+E(K ARdSIFcZ>-C.|I=CR (>w($å<FwD[kw-tZm)rTCҕqY3;GJ^Ө'XgXI)>#DjʛkJIAr@$]R*D<0`C^JiTJvAJRR#)xO&$L䔢SJxOӞt){LPHx lSɃ)Gtȃti-$5 lnJX&)inQ 1 e%1I.4JBr8)ltdƧ3^!ʎB}LJnƿ4LtN:T33 8j{>H;@T}>4RYB+qB f׽]BJQl*"8L=3=S#TNN甔9HOA!eԁ%-> A*0p06L9ߐRH1i \8!zMAIar) k1ߢeE*ёC{t@)[Y{uYnܱ>JLγZLN{[n??.t+swi;ו|*juV4'vӔ8*mEڣڥψt K׺}7&l AQc sskO}#V jk8Lu:O=Jf ϒrٸnl\!22Aӄ [y;4lt!ZV] Ef*Vҍ@$Tb [;()^Ɲ7jw^XqpsA-xWRa7~i2I :(nuA`SIOU-s`x#z`[pҬQH5 t}A쭭LF"S`wI)6GV(Y"EbAed5]ݿT{w LGR6Lx(>R;JGk ( VݖdviĖL.@fYcFz: 5 m+}dkc^ V&H8P ^!,@8}/1dIvBF)[,!;^Кڀtq:)m>Z ^{C^Km18{1놙 LL?hm{xZoNƾ*kseR^A+d,&}TO`-Lg$opȶYMGkjan܃ΞՒC@XkhBVҜh vYU {?a$;0ِ<{])T {4pA1a:4FԢt`|\dK4ܙڟ k4rl57ٸEX RxUI;̢AU:#OHmq56;MROVFyAsu>h2߆w7$Q.? P$"Ty%BɅ|KUI kƀ&Jc@LIMnBu@nI[ MV(BXU$"<9TN@Zm}G$XI Ec' v c\Aegnj۠uCSIp)IU;,zج{(3@x4>k!PQy'1@jMܩi(u(7|#!@9L^S–'h?';OPKyR;K'tr8W}5 mASw%Yڈ{7㑠 m%E/jLmڧ/0,`/;`MKu$Cpíp5c*nvyv~|]sK^bsX@W$]`#iT:9C5wiSAo$4F+ߴ(Rv%فҶ2Hlmkxӿ;<21CX=*X_iúXft&6EMmYm?9h=dA8}+. nٯMsCLB{ ^{GIÏޓ7 'R--R?E}p74@& &d)ˬT19!$mѩ`5{1IOqT{P2r}Hu۞,}745fkcRNQkI5ezpRpl;x lE/Qq/u;G@UqrO&myHmn(6DL[LQ61-s]8H~_lv杺|܌YӰ}s2n`9P͛d~OǚkN6B 1gQsw.0\1 @e5DN ߤ'@0}:K ),`v]q ң G؜cRz*q=K-M>T>eEqxp!0&wh)(pR,A>$Kϊ;ZOnkwQί@rVɪ?=ԍ/q.Gk"<[c'Y[XE]))fgT &b:?CoLcVۻYɲmo06+r8Dt# X[ GC?[̏/ת:y֬aPɭXZd}Ymiv0oǩB4.ݺS#ORve3/u1?Sg xVxٻCI 1ku~7 qoSәKk?-*ѧE7W$CvLZ$9;K٣t)O4%` \'s]Re2qf*{p' wgZc )<@6jac06GE<7[4 h\lѿ;=Fo麟a4;LkT pv:Li#!d1?&҆IҀZ> lsRn#Y@bc7ma?#O!Zk(w\{O_m-M Dsà;(@4l>E5ûJ`]a'?J`暄stV}Y ZTk_`}dKZ`G "5a4Laő');{hx=SPa<DwGU.o}Lp^b @1UϦP˿58$ Od@;IsѧNky))7Uf]=9v?jݵC}%ud9ɮXRCE5RLTDFCǔ7{4Rqq{[088: G\ZFvRgM1w Ge :cJ֙% 6{nlV%5[?FYv4T ϪdzF n9s}c1Qx H;$χ3J&X`wt7P֓2xԸmc*t˞{ډpp$̪Nux{,Z-_Q洳mTgSFU"OH§ mx==#̒vK]Aet -N] ˩3Nrmcݴp 56y+5[k'AZp oJl|'ZUh>g`+'( nƠr45_S l:}2K"zh=)EmlZ6RKcE^`HJ#Zr[A)TM{{GUP.p >Uw -g@J0)vNOI];e.x^R,hineG+"Š ;jlwaqKGgU/qКד 0,;pL;+fOڃFݻ #o}ʽv^KD}&ʛgPamo̗NqLe xq$ç<.~3ʣg D%hmLb}-g歰n1k(0rPjđ